Incidental Mutation 'R3424:Galnt10'
ID267861
Institutional Source Beutler Lab
Gene Symbol Galnt10
Ensembl Gene ENSMUSG00000020520
Gene Namepolypeptide N-acetylgalactosaminyltransferase 10
SynonymsGalnt9, C330012K04Rik, GalNAc-T10
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location57645442-57787514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57645713 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 52 (V52A)
Ref Sequence ENSEMBL: ENSMUSP00000104474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066987] [ENSMUST00000108846]
Predicted Effect probably benign
Transcript: ENSMUST00000066987
AA Change: V52A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065096
Gene: ENSMUSG00000020520
AA Change: V52A

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 38 52 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 145 376 4.7e-8 PFAM
Pfam:Glycos_transf_2 148 333 1.9e-37 PFAM
Pfam:Glyco_tranf_2_2 148 373 3e-7 PFAM
Pfam:Glyco_transf_7C 303 376 2.3e-11 PFAM
RICIN 460 590 4.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108846
AA Change: V52A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104474
Gene: ENSMUSG00000020520
AA Change: V52A

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 38 52 N/A INTRINSIC
PDB:2D7R|A 53 133 5e-44 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142486
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GalNAc polypeptide N-acetylgalactosaminyltransferases. These enzymes catalyze the first step in the synthesis of mucin-type oligosaccharides. These proteins transfer GalNAc from UDP-GalNAc to either serine or threonine residues of polypeptide acceptors. The protein encoded by this locus may have increased catalytic activity toward glycosylated peptides compared to activity toward non-glycosylated peptides.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Galnt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Galnt10 APN 11 57725583 missense probably damaging 1.00
IGL02085:Galnt10 APN 11 57782278 missense probably benign
IGL02154:Galnt10 APN 11 57784705 missense probably damaging 1.00
IGL02418:Galnt10 APN 11 57781168 missense probably benign 0.00
IGL02810:Galnt10 APN 11 57725586 missense probably damaging 0.99
IGL03070:Galnt10 APN 11 57725582 missense probably damaging 1.00
IGL03191:Galnt10 APN 11 57771500 missense probably damaging 1.00
R0257:Galnt10 UTSW 11 57781078 missense probably damaging 1.00
R0483:Galnt10 UTSW 11 57781222 missense probably damaging 1.00
R0681:Galnt10 UTSW 11 57769540 missense probably damaging 1.00
R1102:Galnt10 UTSW 11 57781045 splice site probably benign
R1436:Galnt10 UTSW 11 57771469 missense probably damaging 1.00
R1959:Galnt10 UTSW 11 57765617 missense probably damaging 1.00
R4445:Galnt10 UTSW 11 57783691 missense probably damaging 0.98
R5183:Galnt10 UTSW 11 57769588 missense probably damaging 1.00
R5369:Galnt10 UTSW 11 57765747 critical splice donor site probably null
R5838:Galnt10 UTSW 11 57781056 missense probably damaging 0.99
R6045:Galnt10 UTSW 11 57783793 missense probably damaging 1.00
R6148:Galnt10 UTSW 11 57784648 missense probably damaging 1.00
R6442:Galnt10 UTSW 11 57765622 missense probably benign 0.03
R6851:Galnt10 UTSW 11 57765632 missense probably damaging 1.00
R6873:Galnt10 UTSW 11 57781219 missense probably damaging 1.00
R7013:Galnt10 UTSW 11 57765584 missense probably benign 0.22
R7696:Galnt10 UTSW 11 57769538 missense probably damaging 1.00
R7950:Galnt10 UTSW 11 57783723 missense probably damaging 0.99
R8208:Galnt10 UTSW 11 57645572 missense possibly damaging 0.85
R8264:Galnt10 UTSW 11 57782206 missense probably benign 0.01
Z1088:Galnt10 UTSW 11 57721331 missense possibly damaging 0.93
Z1177:Galnt10 UTSW 11 57737000 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CTCAACCGTGCATCTGTTGG -3'
(R):5'- TTTTAGGCTGGAGCAAGAGC -3'

Sequencing Primer
(F):5'- TACTGCTGGCCGAACTGCTG -3'
(R):5'- GCAAGAGCCTGGATAAATCTTTGACC -3'
Posted On2015-02-18