Incidental Mutation 'R3424:6030469F06Rik'
ID267862
Institutional Source Beutler Lab
Gene Symbol 6030469F06Rik
Ensembl Gene ENSMUSG00000095953
Gene NameRIKEN cDNA 6030469F06 gene
Synonyms
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location31184623-31185177 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 31184633 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218642
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in 6030469F06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01957:6030469F06Rik APN 12 31185043 intron noncoding transcript
R0411:6030469F06Rik UTSW 12 31184731 intron noncoding transcript
R1464:6030469F06Rik UTSW 12 31184915 intron noncoding transcript
R1464:6030469F06Rik UTSW 12 31184915 intron noncoding transcript
R4391:6030469F06Rik UTSW 12 31184623 intron noncoding transcript
R5524:6030469F06Rik UTSW 12 31184863 intron noncoding transcript
R8176:6030469F06Rik UTSW 12 31185136 missense noncoding transcript
R8296:6030469F06Rik UTSW 12 31185059 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCATGAGTGCACCCATCAAG -3'
(R):5'- AAGAGCTCCTGGGTGTTCTC -3'

Sequencing Primer
(F):5'- AGAGGGGCTCTCCTGTACCAC -3'
(R):5'- GAGCTCCTGGGTGTTCTCTTCTTC -3'
Posted On2015-02-18