Incidental Mutation 'R3424:BC016579'
ID267863
Institutional Source Beutler Lab
Gene Symbol BC016579
Ensembl Gene ENSMUSG00000033187
Gene NamecDNA sequence, BC016579
Synonyms
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location45626848-45654068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45629483 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 191 (I191F)
Ref Sequence ENSEMBL: ENSMUSP00000037651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036732]
Predicted Effect probably damaging
Transcript: ENSMUST00000036732
AA Change: I191F

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037651
Gene: ENSMUSG00000033187
AA Change: I191F

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in BC016579
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02818:BC016579 APN 16 45629502 missense probably damaging 0.99
IGL03061:BC016579 APN 16 45629486 missense probably damaging 0.98
BB003:BC016579 UTSW 16 45629462 missense probably damaging 1.00
BB013:BC016579 UTSW 16 45629462 missense probably damaging 1.00
R0026:BC016579 UTSW 16 45640367 missense probably benign 0.02
R0026:BC016579 UTSW 16 45640367 missense probably benign 0.02
R0763:BC016579 UTSW 16 45629455 missense probably damaging 0.97
R3751:BC016579 UTSW 16 45632998 splice site probably null
R4512:BC016579 UTSW 16 45633000 missense possibly damaging 0.61
R5447:BC016579 UTSW 16 45648889 missense probably benign 0.00
R5508:BC016579 UTSW 16 45633006 missense possibly damaging 0.59
R7926:BC016579 UTSW 16 45629462 missense probably damaging 1.00
Z1088:BC016579 UTSW 16 45653948 missense probably benign 0.06
Z1177:BC016579 UTSW 16 45648896 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTCCAGAGCAAGAGATCAGTTTG -3'
(R):5'- TTCCAGGAAGATGTGGAGCC -3'

Sequencing Primer
(F):5'- TTTGTGCAAGAGTGAAGAGTTAC -3'
(R):5'- TGTGGAGCCAAAGAAATATTAATGC -3'
Posted On2015-02-18