Incidental Mutation 'R3424:Hps1'
ID267865
Institutional Source Beutler Lab
Gene Symbol Hps1
Ensembl Gene ENSMUSG00000025188
Gene NameHPS1, biogenesis of lysosomal organelles complex 3 subunit 1
Synonyms6030422N11Rik
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location42755105-42779978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42760513 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 522 (M522K)
Ref Sequence ENSEMBL: ENSMUSP00000071069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026194] [ENSMUST00000069298] [ENSMUST00000160455] [ENSMUST00000162004] [ENSMUST00000162061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026194
AA Change: M514K

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026194
Gene: ENSMUSG00000025188
AA Change: M514K

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000069298
AA Change: M522K

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071069
Gene: ENSMUSG00000025188
AA Change: M522K

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159974
Predicted Effect possibly damaging
Transcript: ENSMUST00000160455
AA Change: M522K

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125662
Gene: ENSMUSG00000025188
AA Change: M522K

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160621
Predicted Effect probably benign
Transcript: ENSMUST00000161252
Predicted Effect possibly damaging
Transcript: ENSMUST00000162004
AA Change: M514K

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125226
Gene: ENSMUSG00000025188
AA Change: M514K

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162061
AA Change: M514K

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124209
Gene: ENSMUSG00000025188
AA Change: M514K

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is a component of three different protein complexes termed biogenesis of lysosome-related organelles complex (BLOC)-3, BLOC4, and BLOC5. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 1. Alternative splicing results in multiple transcript variants. A pseudogene related to this gene is located on chromosome 22. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit hypopigmentation and increased bleeding time. Impaired natural killer cell function, reduced secretion of kidney lysosomal enzymes,and abnormal retinofugal neuronal projections characterize some alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Hps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Hps1 APN 19 42771129 nonsense probably null
IGL02327:Hps1 APN 19 42756345 unclassified probably benign
IGL02488:Hps1 APN 19 42757788 unclassified probably benign
IGL03161:Hps1 APN 19 42767271 missense probably damaging 1.00
R0127:Hps1 UTSW 19 42771111 splice site probably benign
R0134:Hps1 UTSW 19 42766180 missense probably damaging 0.98
R0234:Hps1 UTSW 19 42762553 missense probably damaging 1.00
R0234:Hps1 UTSW 19 42762553 missense probably damaging 1.00
R0394:Hps1 UTSW 19 42770899 splice site probably null
R1435:Hps1 UTSW 19 42762275 missense probably benign 0.04
R1537:Hps1 UTSW 19 42759704 critical splice donor site probably null
R1616:Hps1 UTSW 19 42767185 missense probably damaging 1.00
R1860:Hps1 UTSW 19 42762449 missense probably damaging 1.00
R2014:Hps1 UTSW 19 42762512 missense probably benign 0.00
R4472:Hps1 UTSW 19 42762496 missense probably damaging 1.00
R5476:Hps1 UTSW 19 42769602 splice site probably null
R6054:Hps1 UTSW 19 42770778 missense probably damaging 0.96
R6275:Hps1 UTSW 19 42769607 missense probably null 1.00
R6807:Hps1 UTSW 19 42770778 missense possibly damaging 0.60
R6916:Hps1 UTSW 19 42766725
R7332:Hps1 UTSW 19 42777912 splice site probably null
R7487:Hps1 UTSW 19 42756261 missense probably damaging 1.00
R7504:Hps1 UTSW 19 42766720 missense probably benign 0.00
R7823:Hps1 UTSW 19 42755707 missense possibly damaging 0.58
R7955:Hps1 UTSW 19 42770782 missense probably damaging 0.99
R8198:Hps1 UTSW 19 42767220 missense probably benign 0.05
Z1176:Hps1 UTSW 19 42766686 missense probably null 0.00
Z1177:Hps1 UTSW 19 42755696 missense probably benign 0.00
Z1177:Hps1 UTSW 19 42759831 missense probably damaging 1.00
Z1177:Hps1 UTSW 19 42766218 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACACACATGTCTAGCCTCTGG -3'
(R):5'- TGCAGTGTGTCAGAGAACAG -3'

Sequencing Primer
(F):5'- GCTAAGCCAGGCAGAGGATATGAC -3'
(R):5'- AGCTGCCTCCCTGTGTG -3'
Posted On2015-02-18