Incidental Mutation 'R3426:Olfr1186'
ID267870
Institutional Source Beutler Lab
Gene Symbol Olfr1186
Ensembl Gene ENSMUSG00000082882
Gene Nameolfactory receptor 1186
SynonymsGA_x6K02T2Q125-50012960-50013871, MOR230-5
MMRRC Submission 040644-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3426 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88518551-88526790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88525864 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 94 (C94S)
Ref Sequence ENSEMBL: ENSMUSP00000151114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075025] [ENSMUST00000121619] [ENSMUST00000215912] [ENSMUST00000216978]
Predicted Effect probably damaging
Transcript: ENSMUST00000075025
AA Change: C94S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074542
Gene: ENSMUSG00000057735
AA Change: C94S

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 2.5e-51 PFAM
Pfam:7tm_1 38 284 4.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121619
AA Change: C94S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215912
AA Change: C94S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216978
AA Change: C94S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 C A 8: 24,667,604 C110F probably damaging Het
Adrb3 T C 8: 27,228,181 D80G probably damaging Het
Akap6 A T 12: 52,888,034 N770Y probably damaging Het
Ank3 A G 10: 69,706,894 H28R probably benign Het
Atrn A G 2: 131,020,956 M1319V probably benign Het
BC034090 T C 1: 155,241,498 I291M probably benign Het
Cc2d2a T C 5: 43,736,109 S1416P probably benign Het
Chd6 G T 2: 160,990,255 T999N probably damaging Het
Col9a2 C A 4: 121,050,407 A335E possibly damaging Het
Epb42 A T 2: 121,030,039 L160M probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Igtp G A 11: 58,206,593 V197I probably damaging Het
Nup214 G A 2: 32,033,403 V1315M probably damaging Het
Plek T C 11: 16,990,142 Y166C probably damaging Het
Prdm4 T C 10: 85,910,289 N85D probably damaging Het
Prelid1 T G 13: 55,322,194 V2G probably benign Het
Serac1 T C 17: 6,066,778 I168V probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc22a5 A G 11: 53,869,326 V388A probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpv3 A T 11: 73,285,941 Y382F probably damaging Het
Ttyh1 T C 7: 4,133,219 probably null Het
Ubr2 T C 17: 46,968,439 Y681C probably damaging Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Utp14b T C 1: 78,665,339 M318T probably damaging Het
Vars2 A T 17: 35,661,974 I442N probably damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp606 T C 7: 12,489,664 M34T probably damaging Het
Other mutations in Olfr1186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr1186 APN 2 88525760 missense possibly damaging 0.87
IGL01727:Olfr1186 APN 2 88525927 missense probably benign 0.03
IGL01790:Olfr1186 APN 2 88526423 missense probably damaging 0.99
IGL01868:Olfr1186 APN 2 88525715 missense possibly damaging 0.66
IGL03146:Olfr1186 APN 2 88526144 missense possibly damaging 0.90
IGL03378:Olfr1186 APN 2 88526154 nonsense probably null
R0053:Olfr1186 UTSW 2 88526163 missense probably damaging 1.00
R0829:Olfr1186 UTSW 2 88526228 missense probably damaging 1.00
R1210:Olfr1186 UTSW 2 88526276 missense possibly damaging 0.89
R1754:Olfr1186 UTSW 2 88525815 missense probably damaging 0.99
R2260:Olfr1186 UTSW 2 88526386 missense possibly damaging 0.93
R3781:Olfr1186 UTSW 2 88526365 missense probably benign 0.23
R4737:Olfr1186 UTSW 2 88526225 missense probably damaging 1.00
R4908:Olfr1186 UTSW 2 88525910 missense probably damaging 1.00
R4932:Olfr1186 UTSW 2 88525735 missense probably benign 0.02
R5071:Olfr1186 UTSW 2 88526041 missense probably damaging 1.00
R5831:Olfr1186 UTSW 2 88526480 nonsense probably null
R6222:Olfr1186 UTSW 2 88499270 missense probably benign 0.34
R6370:Olfr1186 UTSW 2 88499368 nonsense probably null
R6802:Olfr1186 UTSW 2 88525597 missense probably benign 0.02
R6931:Olfr1186 UTSW 2 88526194 missense possibly damaging 0.50
R7044:Olfr1186 UTSW 2 88526486 missense probably benign
R7121:Olfr1186 UTSW 2 88525826 missense probably damaging 1.00
R7166:Olfr1186 UTSW 2 88525646 missense possibly damaging 0.89
R7387:Olfr1186 UTSW 2 88526400 nonsense probably null
R7891:Olfr1186 UTSW 2 88525945 missense probably benign 0.04
R7951:Olfr1186 UTSW 2 88525804 missense probably damaging 0.98
R7978:Olfr1186 UTSW 2 88525670 nonsense probably null
R8016:Olfr1186 UTSW 2 88526173 missense probably damaging 0.99
R8039:Olfr1186 UTSW 2 88525871 missense probably benign 0.07
R8389:Olfr1186 UTSW 2 88525587 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- AATGGGGAACTTTCTCATAATGGTG -3'
(R):5'- TCACATTTGGGCCACAGAATG -3'

Sequencing Primer
(F):5'- GACCATTAAGATGAGTCAGACACTTG -3'
(R):5'- CCACAGAATGGTAGTCTTAAGGC -3'
Posted On2015-02-18