Mutagenetix > Incidental Mutations

Incidental Mutation 'R3426:Chd6'

267873

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

040644-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.804) question?

Stock #

R3426 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 160990255 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 999 (T999N)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039782
AA Change: T999N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: T999N

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000134178
AA Change: T998N

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: T998N

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	213	228	N/A	INTRINSIC
CHROMO	288	354	1.35e-4	SMART
CHROMO	371	429	3.48e-7	SMART
DEXDc	455	657	1.73e-39	SMART
HELICc	811	895	3.84e-23	SMART
low complexity region	1079	1093	N/A	INTRINSIC
Blast:DEXDc	1107	1152	4e-23	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149866

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	C	A	8: 24,667,604	C110F	probably damaging	Het
Adrb3	T	C	8: 27,228,181	D80G	probably damaging	Het
Akap6	A	T	12: 52,888,034	N770Y	probably damaging	Het
Ank3	A	G	10: 69,706,894	H28R	probably benign	Het
Atrn	A	G	2: 131,020,956	M1319V	probably benign	Het
BC034090	T	C	1: 155,241,498	I291M	probably benign	Het
Cc2d2a	T	C	5: 43,736,109	S1416P	probably benign	Het
Col9a2	C	A	4: 121,050,407	A335E	possibly damaging	Het
Epb42	A	T	2: 121,030,039	L160M	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Igtp	G	A	11: 58,206,593	V197I	probably damaging	Het
Nup214	G	A	2: 32,033,403	V1315M	probably damaging	Het
Olfr1186	T	A	2: 88,525,864	C94S	probably damaging	Het
Plek	T	C	11: 16,990,142	Y166C	probably damaging	Het
Prdm4	T	C	10: 85,910,289	N85D	probably damaging	Het
Prelid1	T	G	13: 55,322,194	V2G	probably benign	Het
Serac1	T	C	17: 6,066,778	I168V	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Slc22a5	A	G	11: 53,869,326	V388A	probably benign	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpv3	A	T	11: 73,285,941	Y382F	probably damaging	Het
Ttyh1	T	C	7: 4,133,219		probably null	Het
Ubr2	T	C	17: 46,968,439	Y681C	probably damaging	Het
Unc80	G	A	1: 66,639,305	V2082I	probably benign	Het
Utp14b	T	C	1: 78,665,339	M318T	probably damaging	Het
Vars2	A	T	17: 35,661,974	I442N	probably damaging	Het
Vmn2r63	A	G	7: 42,926,982	F469S	probably benign	Het
Wtap	C	T	17: 12,967,538	R374Q	possibly damaging	Het
Zfp606	T	C	7: 12,489,664	M34T	probably damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161025943	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160957082	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161019651	missense	probably damaging	1.00
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCAAGGGTTTTGGAGCAG -3'
(R):5'- ACTTTGGTGACCTGCTCAG -3'

Sequencing Primer
(F):5'- TTTGGAGCAGATCTTGTAAAGAGTAG -3'
(R):5'- TGCTCAGGTACAGCAGCTCTC -3'

Posted On

2015-02-18