Incidental Mutation 'R3426:Chd6'
ID 267873
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Name chromodomain helicase DNA binding protein 6
Synonyms 6330406J24Rik, 5430439G14Rik
MMRRC Submission 040644-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.755) question?
Stock # R3426 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 160946978-161109075 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 160990255 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 999 (T999N)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: T999N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: T999N

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134178
AA Change: T998N

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: T998N

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
CHROMO 288 354 1.35e-4 SMART
CHROMO 371 429 3.48e-7 SMART
DEXDc 455 657 1.73e-39 SMART
HELICc 811 895 3.84e-23 SMART
low complexity region 1079 1093 N/A INTRINSIC
Blast:DEXDc 1107 1152 4e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149866
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 C A 8: 24,667,604 (GRCm38) C110F probably damaging Het
Adrb3 T C 8: 27,228,181 (GRCm38) D80G probably damaging Het
Akap6 A T 12: 52,888,034 (GRCm38) N770Y probably damaging Het
Ank3 A G 10: 69,706,894 (GRCm38) H28R probably benign Het
Atrn A G 2: 131,020,956 (GRCm38) M1319V probably benign Het
BC034090 T C 1: 155,241,498 (GRCm38) I291M probably benign Het
Cc2d2a T C 5: 43,736,109 (GRCm38) S1416P probably benign Het
Col9a2 C A 4: 121,050,407 (GRCm38) A335E possibly damaging Het
Epb42 A T 2: 121,030,039 (GRCm38) L160M probably damaging Het
Gkn3 C T 6: 87,383,525 (GRCm38) A163T probably damaging Het
Igtp G A 11: 58,206,593 (GRCm38) V197I probably damaging Het
Nup214 G A 2: 32,033,403 (GRCm38) V1315M probably damaging Het
Olfr1186 T A 2: 88,525,864 (GRCm38) C94S probably damaging Het
Plek T C 11: 16,990,142 (GRCm38) Y166C probably damaging Het
Prdm4 T C 10: 85,910,289 (GRCm38) N85D probably damaging Het
Prelid1 T G 13: 55,322,194 (GRCm38) V2G probably benign Het
Serac1 T C 17: 6,066,778 (GRCm38) I168V probably benign Het
Setx GTGGCT GT 2: 29,154,061 (GRCm38) 1814 probably null Het
Slc22a5 A G 11: 53,869,326 (GRCm38) V388A probably benign Het
Tmem181a T A 17: 6,295,786 (GRCm38) L185H probably damaging Het
Tns2 C T 15: 102,108,934 (GRCm38) R281C probably damaging Het
Trpv3 A T 11: 73,285,941 (GRCm38) Y382F probably damaging Het
Ttyh1 T C 7: 4,133,219 (GRCm38) probably null Het
Ubr2 T C 17: 46,968,439 (GRCm38) Y681C probably damaging Het
Unc80 G A 1: 66,639,305 (GRCm38) V2082I probably benign Het
Utp14b T C 1: 78,665,339 (GRCm38) M318T probably damaging Het
Vars2 A T 17: 35,661,974 (GRCm38) I442N probably damaging Het
Vmn2r63 A G 7: 42,926,982 (GRCm38) F469S probably benign Het
Wtap C T 17: 12,967,538 (GRCm38) R374Q possibly damaging Het
Zfp606 T C 7: 12,489,664 (GRCm38) M34T probably damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161,042,079 (GRCm38) missense probably benign 0.01
IGL00899:Chd6 APN 2 161,029,298 (GRCm38) splice site probably benign
IGL01104:Chd6 APN 2 160,961,927 (GRCm38) missense probably damaging 1.00
IGL01295:Chd6 APN 2 160,988,370 (GRCm38) splice site probably benign
IGL01717:Chd6 APN 2 160,965,259 (GRCm38) missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160,961,374 (GRCm38) missense probably benign 0.00
IGL01814:Chd6 APN 2 161,059,929 (GRCm38) missense probably benign 0.25
IGL02016:Chd6 APN 2 160,983,678 (GRCm38) missense probably damaging 1.00
IGL02104:Chd6 APN 2 160,977,512 (GRCm38) missense probably benign
IGL02158:Chd6 APN 2 161,026,292 (GRCm38) missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160,965,675 (GRCm38) missense probably damaging 1.00
IGL02472:Chd6 APN 2 160,984,452 (GRCm38) splice site probably benign
IGL02522:Chd6 APN 2 160,965,796 (GRCm38) missense probably benign 0.30
IGL02626:Chd6 APN 2 161,039,350 (GRCm38) splice site probably benign
IGL02727:Chd6 APN 2 160,969,463 (GRCm38) missense probably damaging 0.96
IGL02738:Chd6 APN 2 160,965,698 (GRCm38) missense probably benign 0.45
IGL02743:Chd6 APN 2 160,960,263 (GRCm38) missense probably damaging 1.00
IGL02800:Chd6 APN 2 160,984,632 (GRCm38) missense probably damaging 1.00
IGL02811:Chd6 APN 2 160,990,301 (GRCm38) missense probably damaging 1.00
IGL02850:Chd6 APN 2 161,019,616 (GRCm38) nonsense probably null
IGL02979:Chd6 APN 2 160,966,170 (GRCm38) missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161,052,384 (GRCm38) splice site probably benign
IGL03277:Chd6 APN 2 160,983,061 (GRCm38) missense probably null 1.00
IGL03346:Chd6 APN 2 160,960,362 (GRCm38) missense probably benign 0.00
IGL03357:Chd6 APN 2 161,018,016 (GRCm38) splice site probably benign
IGL03134:Chd6 UTSW 2 160,965,483 (GRCm38) missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160,967,902 (GRCm38) missense probably damaging 1.00
R0106:Chd6 UTSW 2 160,967,902 (GRCm38) missense probably damaging 1.00
R0212:Chd6 UTSW 2 161,052,847 (GRCm38) missense probably damaging 0.99
R0363:Chd6 UTSW 2 161,014,324 (GRCm38) missense probably damaging 1.00
R0399:Chd6 UTSW 2 161,052,688 (GRCm38) missense probably damaging 1.00
R0511:Chd6 UTSW 2 160,992,191 (GRCm38) missense probably damaging 0.99
R0771:Chd6 UTSW 2 161,019,580 (GRCm38) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,990,271 (GRCm38) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,990,271 (GRCm38) missense probably damaging 1.00
R1184:Chd6 UTSW 2 161,030,802 (GRCm38) missense probably damaging 1.00
R1277:Chd6 UTSW 2 160,967,815 (GRCm38) missense probably damaging 1.00
R1396:Chd6 UTSW 2 160,983,103 (GRCm38) missense probably damaging 1.00
R1647:Chd6 UTSW 2 161,042,058 (GRCm38) missense probably damaging 1.00
R1648:Chd6 UTSW 2 161,042,058 (GRCm38) missense probably damaging 1.00
R1745:Chd6 UTSW 2 160,981,667 (GRCm38) missense probably damaging 0.96
R1766:Chd6 UTSW 2 160,966,639 (GRCm38) missense probably damaging 1.00
R1871:Chd6 UTSW 2 160,990,256 (GRCm38) missense probably damaging 1.00
R1928:Chd6 UTSW 2 160,968,000 (GRCm38) splice site probably benign
R1973:Chd6 UTSW 2 160,966,387 (GRCm38) missense probably damaging 0.99
R2200:Chd6 UTSW 2 160,983,753 (GRCm38) missense probably damaging 1.00
R2340:Chd6 UTSW 2 160,965,759 (GRCm38) frame shift probably null
R2341:Chd6 UTSW 2 160,965,759 (GRCm38) frame shift probably null
R2519:Chd6 UTSW 2 161,029,876 (GRCm38) missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160,967,880 (GRCm38) missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160,966,552 (GRCm38) small deletion probably benign
R3427:Chd6 UTSW 2 160,990,255 (GRCm38) missense probably damaging 1.00
R4042:Chd6 UTSW 2 160,988,333 (GRCm38) missense probably damaging 1.00
R4273:Chd6 UTSW 2 160,961,291 (GRCm38) missense probably benign 0.04
R4360:Chd6 UTSW 2 160,949,856 (GRCm38) missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160,965,318 (GRCm38) missense probably benign
R4458:Chd6 UTSW 2 161,029,876 (GRCm38) missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161,014,194 (GRCm38) missense probably damaging 1.00
R4625:Chd6 UTSW 2 160,969,492 (GRCm38) missense probably damaging 1.00
R4740:Chd6 UTSW 2 160,970,183 (GRCm38) missense probably benign
R4765:Chd6 UTSW 2 160,966,244 (GRCm38) nonsense probably null
R4779:Chd6 UTSW 2 160,949,557 (GRCm38) missense probably damaging 1.00
R4877:Chd6 UTSW 2 161,029,299 (GRCm38) splice site probably benign
R5068:Chd6 UTSW 2 160,966,369 (GRCm38) missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160,949,953 (GRCm38) missense probably damaging 1.00
R5275:Chd6 UTSW 2 160,969,363 (GRCm38) missense probably benign
R5405:Chd6 UTSW 2 160,965,390 (GRCm38) missense probably benign
R5598:Chd6 UTSW 2 161,014,112 (GRCm38) missense probably damaging 1.00
R5693:Chd6 UTSW 2 160,965,265 (GRCm38) missense probably benign
R5697:Chd6 UTSW 2 161,018,051 (GRCm38) missense probably damaging 1.00
R5715:Chd6 UTSW 2 160,949,878 (GRCm38) missense probably benign 0.00
R5759:Chd6 UTSW 2 160,983,762 (GRCm38) missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160,957,079 (GRCm38) missense probably damaging 1.00
R5761:Chd6 UTSW 2 160,957,078 (GRCm38) missense probably damaging 1.00
R5954:Chd6 UTSW 2 160,965,827 (GRCm38) missense probably benign 0.00
R6025:Chd6 UTSW 2 160,965,582 (GRCm38) missense probably benign
R6104:Chd6 UTSW 2 161,014,132 (GRCm38) missense probably damaging 1.00
R6247:Chd6 UTSW 2 160,950,048 (GRCm38) missense probably damaging 1.00
R6393:Chd6 UTSW 2 160,979,487 (GRCm38) missense probably damaging 1.00
R6452:Chd6 UTSW 2 160,965,498 (GRCm38) missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161,013,067 (GRCm38) missense probably damaging 1.00
R6784:Chd6 UTSW 2 160,966,254 (GRCm38) missense probably damaging 1.00
R6803:Chd6 UTSW 2 160,960,359 (GRCm38) missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160,965,730 (GRCm38) missense probably benign
R6895:Chd6 UTSW 2 160,988,340 (GRCm38) missense probably damaging 1.00
R6925:Chd6 UTSW 2 161,013,127 (GRCm38) missense probably damaging 0.98
R7061:Chd6 UTSW 2 161,025,965 (GRCm38) nonsense probably null
R7064:Chd6 UTSW 2 160,950,063 (GRCm38) missense probably damaging 1.00
R7248:Chd6 UTSW 2 160,961,279 (GRCm38) nonsense probably null
R7287:Chd6 UTSW 2 161,008,392 (GRCm38) missense probably benign 0.07
R7431:Chd6 UTSW 2 161,026,328 (GRCm38) missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160,950,003 (GRCm38) missense probably damaging 1.00
R7509:Chd6 UTSW 2 161,013,154 (GRCm38) missense probably damaging 1.00
R7699:Chd6 UTSW 2 161,025,943 (GRCm38) missense probably benign 0.13
R7748:Chd6 UTSW 2 160,966,619 (GRCm38) missense probably benign 0.37
R7785:Chd6 UTSW 2 160,970,175 (GRCm38) missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160,990,321 (GRCm38) missense probably damaging 1.00
R8261:Chd6 UTSW 2 160,957,082 (GRCm38) missense probably damaging 1.00
R8317:Chd6 UTSW 2 160,990,321 (GRCm38) missense probably damaging 1.00
R8388:Chd6 UTSW 2 161,019,651 (GRCm38) missense probably damaging 1.00
R8865:Chd6 UTSW 2 161,021,069 (GRCm38) missense probably benign 0.10
R8867:Chd6 UTSW 2 161,021,069 (GRCm38) missense probably benign 0.10
R8996:Chd6 UTSW 2 160,981,623 (GRCm38) missense probably damaging 1.00
R9091:Chd6 UTSW 2 161,029,873 (GRCm38) nonsense probably null
R9270:Chd6 UTSW 2 161,029,873 (GRCm38) nonsense probably null
R9310:Chd6 UTSW 2 161,039,261 (GRCm38) missense probably damaging 1.00
R9367:Chd6 UTSW 2 161,029,864 (GRCm38) missense possibly damaging 0.83
R9438:Chd6 UTSW 2 160,957,158 (GRCm38) missense probably benign 0.01
R9756:Chd6 UTSW 2 160,960,339 (GRCm38) missense probably benign
Z1088:Chd6 UTSW 2 160,966,488 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAAGGGTTTTGGAGCAG -3'
(R):5'- ACTTTGGTGACCTGCTCAG -3'

Sequencing Primer
(F):5'- TTTGGAGCAGATCTTGTAAAGAGTAG -3'
(R):5'- TGCTCAGGTACAGCAGCTCTC -3'
Posted On 2015-02-18