Incidental Mutation 'R3426:Igtp'
ID267886
Institutional Source Beutler Lab
Gene Symbol Igtp
Ensembl Gene ENSMUSG00000078853
Gene Nameinterferon gamma induced GTPase
SynonymsIrgm3
MMRRC Submission 040644-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3426 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58199556-58207591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58206593 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 197 (V197I)
Ref Sequence ENSEMBL: ENSMUSP00000047356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035266] [ENSMUST00000058704] [ENSMUST00000094169] [ENSMUST00000168280]
Predicted Effect probably damaging
Transcript: ENSMUST00000035266
AA Change: V197I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047356
Gene: ENSMUSG00000078853
AA Change: V197I

DomainStartEndE-ValueType
Pfam:IIGP 50 412 4.6e-161 PFAM
Pfam:MMR_HSR1 86 200 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058704
SMART Domains Protein: ENSMUSP00000056001
Gene: ENSMUSG00000069874

DomainStartEndE-ValueType
Pfam:IIGP 30 387 8.1e-165 PFAM
Pfam:MMR_HSR1 66 179 9.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094169
Predicted Effect probably benign
Transcript: ENSMUST00000168280
Meta Mutation Damage Score 0.2731 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. They do have a severely compromised response to Toxoplasma gondii infections however [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 C A 8: 24,667,604 C110F probably damaging Het
Adrb3 T C 8: 27,228,181 D80G probably damaging Het
Akap6 A T 12: 52,888,034 N770Y probably damaging Het
Ank3 A G 10: 69,706,894 H28R probably benign Het
Atrn A G 2: 131,020,956 M1319V probably benign Het
BC034090 T C 1: 155,241,498 I291M probably benign Het
Cc2d2a T C 5: 43,736,109 S1416P probably benign Het
Chd6 G T 2: 160,990,255 T999N probably damaging Het
Col9a2 C A 4: 121,050,407 A335E possibly damaging Het
Epb42 A T 2: 121,030,039 L160M probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Nup214 G A 2: 32,033,403 V1315M probably damaging Het
Olfr1186 T A 2: 88,525,864 C94S probably damaging Het
Plek T C 11: 16,990,142 Y166C probably damaging Het
Prdm4 T C 10: 85,910,289 N85D probably damaging Het
Prelid1 T G 13: 55,322,194 V2G probably benign Het
Serac1 T C 17: 6,066,778 I168V probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc22a5 A G 11: 53,869,326 V388A probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpv3 A T 11: 73,285,941 Y382F probably damaging Het
Ttyh1 T C 7: 4,133,219 probably null Het
Ubr2 T C 17: 46,968,439 Y681C probably damaging Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Utp14b T C 1: 78,665,339 M318T probably damaging Het
Vars2 A T 17: 35,661,974 I442N probably damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp606 T C 7: 12,489,664 M34T probably damaging Het
Other mutations in Igtp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Igtp APN 11 58206144 missense possibly damaging 0.66
IGL03326:Igtp APN 11 58206228 missense probably benign 0.01
R0281:Igtp UTSW 11 58206054 missense probably damaging 0.97
R2762:Igtp UTSW 11 58206065 missense possibly damaging 0.91
R3427:Igtp UTSW 11 58206593 missense probably damaging 0.99
R3428:Igtp UTSW 11 58206593 missense probably damaging 0.99
R4484:Igtp UTSW 11 58206998 missense possibly damaging 0.91
R4588:Igtp UTSW 11 58206682 missense probably damaging 1.00
R5299:Igtp UTSW 11 58207133 missense possibly damaging 0.79
R5652:Igtp UTSW 11 58206629 missense probably benign 0.07
R5662:Igtp UTSW 11 58206279 missense probably damaging 1.00
R5893:Igtp UTSW 11 58206648 missense probably damaging 1.00
R7657:Igtp UTSW 11 58206828 missense probably benign 0.02
R7738:Igtp UTSW 11 58207080 missense probably benign 0.00
R7989:Igtp UTSW 11 58206379 missense probably damaging 0.99
R8920:Igtp UTSW 11 58206173 missense probably damaging 0.98
Z1186:Igtp UTSW 11 58206343 missense probably damaging 0.99
Z1186:Igtp UTSW 11 58206965 missense possibly damaging 0.55
Z1186:Igtp UTSW 11 58207118 missense probably benign 0.00
Z1187:Igtp UTSW 11 58206343 missense probably damaging 0.99
Z1187:Igtp UTSW 11 58206965 missense possibly damaging 0.55
Z1187:Igtp UTSW 11 58207118 missense probably benign 0.00
Z1188:Igtp UTSW 11 58206343 missense probably damaging 0.99
Z1188:Igtp UTSW 11 58206965 missense possibly damaging 0.55
Z1188:Igtp UTSW 11 58207118 missense probably benign 0.00
Z1189:Igtp UTSW 11 58206343 missense probably damaging 0.99
Z1189:Igtp UTSW 11 58206965 missense possibly damaging 0.55
Z1189:Igtp UTSW 11 58207118 missense probably benign 0.00
Z1190:Igtp UTSW 11 58206343 missense probably damaging 0.99
Z1190:Igtp UTSW 11 58206590 missense possibly damaging 0.84
Z1190:Igtp UTSW 11 58206965 missense possibly damaging 0.55
Z1190:Igtp UTSW 11 58207118 missense probably benign 0.00
Z1191:Igtp UTSW 11 58206343 missense probably damaging 0.99
Z1191:Igtp UTSW 11 58206965 missense possibly damaging 0.55
Z1191:Igtp UTSW 11 58207118 missense probably benign 0.00
Z1192:Igtp UTSW 11 58206343 missense probably damaging 0.99
Z1192:Igtp UTSW 11 58206965 missense possibly damaging 0.55
Z1192:Igtp UTSW 11 58207118 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTTCCCTATGTGGAGCTGTG -3'
(R):5'- CTCTGTACCTGATGCTGAAGATG -3'

Sequencing Primer
(F):5'- CCTATGTGGAGCTGTGGGACC -3'
(R):5'- ACCTGATGCTGAAGATGTCTTTTTGC -3'
Posted On2015-02-18