Incidental Mutation 'R3426:Ubr2'
ID 267897
Institutional Source Beutler Lab
Gene Symbol Ubr2
Ensembl Gene ENSMUSG00000023977
Gene Name ubiquitin protein ligase E3 component n-recognin 2
Synonyms ENSMUSG00000043296, E130209G04Rik, 9930021A08Rik
MMRRC Submission 040644-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.891) question?
Stock # R3426 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 47239221-47321482 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 47279365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 681 (Y681C)
Ref Sequence ENSEMBL: ENSMUSP00000108963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337] [ENSMUST00000225599]
AlphaFold Q6WKZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000113335
AA Change: Y681C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: Y681C

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113337
AA Change: Y681C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: Y681C

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 222 301 6.2e-26 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224759
Predicted Effect probably benign
Transcript: ENSMUST00000225599
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 C A 8: 25,157,620 (GRCm39) C110F probably damaging Het
Adrb3 T C 8: 27,718,209 (GRCm39) D80G probably damaging Het
Akap6 A T 12: 52,934,817 (GRCm39) N770Y probably damaging Het
Ank3 A G 10: 69,542,724 (GRCm39) H28R probably benign Het
Atrn A G 2: 130,862,876 (GRCm39) M1319V probably benign Het
BC034090 T C 1: 155,117,244 (GRCm39) I291M probably benign Het
Cc2d2a T C 5: 43,893,451 (GRCm39) S1416P probably benign Het
Chd6 G T 2: 160,832,175 (GRCm39) T999N probably damaging Het
Col9a2 C A 4: 120,907,604 (GRCm39) A335E possibly damaging Het
Epb42 A T 2: 120,860,520 (GRCm39) L160M probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Igtp G A 11: 58,097,419 (GRCm39) V197I probably damaging Het
Nup214 G A 2: 31,923,415 (GRCm39) V1315M probably damaging Het
Or4c100 T A 2: 88,356,208 (GRCm39) C94S probably damaging Het
Plek T C 11: 16,940,142 (GRCm39) Y166C probably damaging Het
Prdm4 T C 10: 85,746,153 (GRCm39) N85D probably damaging Het
Prelid1 T G 13: 55,470,007 (GRCm39) V2G probably benign Het
Serac1 T C 17: 6,117,053 (GRCm39) I168V probably benign Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Slc22a5 A G 11: 53,760,152 (GRCm39) V388A probably benign Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trpv3 A T 11: 73,176,767 (GRCm39) Y382F probably damaging Het
Ttyh1 T C 7: 4,136,218 (GRCm39) probably null Het
Unc80 G A 1: 66,678,464 (GRCm39) V2082I probably benign Het
Utp14b T C 1: 78,643,056 (GRCm39) M318T probably damaging Het
Vars2 A T 17: 35,972,866 (GRCm39) I442N probably damaging Het
Vmn2r63 A G 7: 42,576,406 (GRCm39) F469S probably benign Het
Wtap C T 17: 13,186,425 (GRCm39) R374Q possibly damaging Het
Zfp606 T C 7: 12,223,591 (GRCm39) M34T probably damaging Het
Other mutations in Ubr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ubr2 APN 17 47,296,986 (GRCm39) splice site probably benign
IGL00332:Ubr2 APN 17 47,301,916 (GRCm39) critical splice donor site probably null
IGL00518:Ubr2 APN 17 47,303,922 (GRCm39) missense probably damaging 1.00
IGL00693:Ubr2 APN 17 47,283,907 (GRCm39) missense probably benign 0.01
IGL00785:Ubr2 APN 17 47,255,791 (GRCm39) missense possibly damaging 0.69
IGL01144:Ubr2 APN 17 47,268,247 (GRCm39) missense probably damaging 1.00
IGL01459:Ubr2 APN 17 47,241,435 (GRCm39) splice site probably benign
IGL01637:Ubr2 APN 17 47,267,580 (GRCm39) missense probably damaging 1.00
IGL01710:Ubr2 APN 17 47,254,335 (GRCm39) missense probably benign 0.00
IGL01726:Ubr2 APN 17 47,303,907 (GRCm39) splice site probably benign
IGL01925:Ubr2 APN 17 47,265,875 (GRCm39) missense possibly damaging 0.92
IGL01960:Ubr2 APN 17 47,284,893 (GRCm39) missense probably benign 0.45
IGL02170:Ubr2 APN 17 47,278,123 (GRCm39) missense probably benign 0.05
IGL02308:Ubr2 APN 17 47,245,119 (GRCm39) missense probably damaging 1.00
IGL02387:Ubr2 APN 17 47,274,076 (GRCm39) missense probably benign
IGL02696:Ubr2 APN 17 47,274,691 (GRCm39) missense probably benign
IGL02726:Ubr2 APN 17 47,283,847 (GRCm39) missense probably damaging 1.00
IGL02750:Ubr2 APN 17 47,280,208 (GRCm39) missense probably benign 0.00
IGL02934:Ubr2 APN 17 47,268,266 (GRCm39) missense possibly damaging 0.50
IGL02959:Ubr2 APN 17 47,286,877 (GRCm39) missense probably damaging 0.96
IGL03018:Ubr2 APN 17 47,264,972 (GRCm39) missense possibly damaging 0.64
IGL03343:Ubr2 APN 17 47,262,844 (GRCm39) missense probably benign 0.00
PIT4280001:Ubr2 UTSW 17 47,255,789 (GRCm39) missense probably damaging 1.00
R0044:Ubr2 UTSW 17 47,303,911 (GRCm39) splice site probably benign
R0044:Ubr2 UTSW 17 47,303,911 (GRCm39) splice site probably benign
R0446:Ubr2 UTSW 17 47,294,224 (GRCm39) missense probably damaging 1.00
R0513:Ubr2 UTSW 17 47,297,705 (GRCm39) nonsense probably null
R0565:Ubr2 UTSW 17 47,266,812 (GRCm39) missense probably damaging 1.00
R0600:Ubr2 UTSW 17 47,278,174 (GRCm39) missense probably damaging 0.99
R0690:Ubr2 UTSW 17 47,249,579 (GRCm39) missense probably damaging 0.97
R0710:Ubr2 UTSW 17 47,249,607 (GRCm39) missense probably damaging 0.96
R0761:Ubr2 UTSW 17 47,294,242 (GRCm39) missense probably damaging 1.00
R0798:Ubr2 UTSW 17 47,280,102 (GRCm39) splice site probably benign
R0862:Ubr2 UTSW 17 47,278,009 (GRCm39) nonsense probably null
R0947:Ubr2 UTSW 17 47,252,038 (GRCm39) missense probably damaging 0.99
R0972:Ubr2 UTSW 17 47,245,187 (GRCm39) splice site probably null
R1500:Ubr2 UTSW 17 47,297,615 (GRCm39) missense possibly damaging 0.79
R1514:Ubr2 UTSW 17 47,311,749 (GRCm39) missense probably damaging 1.00
R1533:Ubr2 UTSW 17 47,278,173 (GRCm39) nonsense probably null
R1554:Ubr2 UTSW 17 47,283,877 (GRCm39) missense probably benign
R1575:Ubr2 UTSW 17 47,243,418 (GRCm39) missense probably damaging 1.00
R1602:Ubr2 UTSW 17 47,251,987 (GRCm39) missense probably benign 0.30
R1941:Ubr2 UTSW 17 47,284,952 (GRCm39) missense probably damaging 1.00
R1966:Ubr2 UTSW 17 47,265,845 (GRCm39) missense probably benign 0.05
R2041:Ubr2 UTSW 17 47,296,973 (GRCm39) missense probably damaging 1.00
R2067:Ubr2 UTSW 17 47,274,071 (GRCm39) critical splice donor site probably null
R2111:Ubr2 UTSW 17 47,274,071 (GRCm39) critical splice donor site probably null
R2189:Ubr2 UTSW 17 47,254,290 (GRCm39) missense probably benign 0.01
R2219:Ubr2 UTSW 17 47,296,968 (GRCm39) missense possibly damaging 0.94
R2307:Ubr2 UTSW 17 47,277,141 (GRCm39) nonsense probably null
R3428:Ubr2 UTSW 17 47,279,365 (GRCm39) missense probably damaging 1.00
R3608:Ubr2 UTSW 17 47,255,449 (GRCm39) missense probably damaging 1.00
R4080:Ubr2 UTSW 17 47,299,648 (GRCm39) missense probably benign 0.05
R4330:Ubr2 UTSW 17 47,278,204 (GRCm39) missense probably null 1.00
R4383:Ubr2 UTSW 17 47,250,313 (GRCm39) missense probably benign 0.01
R4460:Ubr2 UTSW 17 47,255,971 (GRCm39) critical splice donor site probably null
R4794:Ubr2 UTSW 17 47,241,371 (GRCm39) missense probably damaging 1.00
R4902:Ubr2 UTSW 17 47,296,922 (GRCm39) missense possibly damaging 0.91
R4913:Ubr2 UTSW 17 47,270,385 (GRCm39) splice site probably null
R5092:Ubr2 UTSW 17 47,280,173 (GRCm39) missense probably damaging 1.00
R5209:Ubr2 UTSW 17 47,279,350 (GRCm39) missense probably damaging 1.00
R5226:Ubr2 UTSW 17 47,294,196 (GRCm39) missense probably benign 0.04
R5250:Ubr2 UTSW 17 47,241,368 (GRCm39) missense probably benign 0.01
R5437:Ubr2 UTSW 17 47,274,623 (GRCm39) missense probably benign 0.00
R5607:Ubr2 UTSW 17 47,245,126 (GRCm39) nonsense probably null
R5848:Ubr2 UTSW 17 47,267,581 (GRCm39) missense possibly damaging 0.84
R6089:Ubr2 UTSW 17 47,293,218 (GRCm39) missense possibly damaging 0.95
R6382:Ubr2 UTSW 17 47,268,241 (GRCm39) missense possibly damaging 0.56
R6552:Ubr2 UTSW 17 47,277,194 (GRCm39) splice site probably null
R6630:Ubr2 UTSW 17 47,262,910 (GRCm39) missense possibly damaging 0.51
R6892:Ubr2 UTSW 17 47,245,034 (GRCm39) missense probably damaging 0.99
R6936:Ubr2 UTSW 17 47,283,957 (GRCm39) missense possibly damaging 0.94
R7039:Ubr2 UTSW 17 47,321,139 (GRCm39) missense probably benign 0.01
R7050:Ubr2 UTSW 17 47,272,528 (GRCm39) missense probably benign 0.30
R7078:Ubr2 UTSW 17 47,266,779 (GRCm39) missense possibly damaging 0.59
R7126:Ubr2 UTSW 17 47,284,982 (GRCm39) splice site probably null
R7219:Ubr2 UTSW 17 47,246,360 (GRCm39) nonsense probably null
R7262:Ubr2 UTSW 17 47,311,665 (GRCm39) missense probably damaging 0.97
R7352:Ubr2 UTSW 17 47,241,352 (GRCm39) missense probably benign 0.19
R7366:Ubr2 UTSW 17 47,266,771 (GRCm39) missense probably damaging 0.99
R7449:Ubr2 UTSW 17 47,275,714 (GRCm39) missense probably damaging 1.00
R7496:Ubr2 UTSW 17 47,301,917 (GRCm39) critical splice donor site probably null
R7759:Ubr2 UTSW 17 47,296,974 (GRCm39) missense probably damaging 1.00
R7869:Ubr2 UTSW 17 47,301,934 (GRCm39) missense probably benign 0.00
R7916:Ubr2 UTSW 17 47,279,308 (GRCm39) critical splice donor site probably null
R8236:Ubr2 UTSW 17 47,262,835 (GRCm39) missense probably benign
R8376:Ubr2 UTSW 17 47,253,721 (GRCm39) missense probably benign 0.07
R9026:Ubr2 UTSW 17 47,245,041 (GRCm39) missense probably damaging 1.00
R9216:Ubr2 UTSW 17 47,292,285 (GRCm39) missense probably benign 0.36
R9339:Ubr2 UTSW 17 47,284,865 (GRCm39) missense probably benign 0.30
R9558:Ubr2 UTSW 17 47,262,843 (GRCm39) missense probably benign
R9606:Ubr2 UTSW 17 47,245,020 (GRCm39) missense probably damaging 1.00
R9644:Ubr2 UTSW 17 47,266,706 (GRCm39) critical splice donor site probably null
R9731:Ubr2 UTSW 17 47,274,071 (GRCm39) critical splice donor site probably null
X0027:Ubr2 UTSW 17 47,311,555 (GRCm39) missense probably damaging 0.99
X0061:Ubr2 UTSW 17 47,281,037 (GRCm39) missense possibly damaging 0.88
Z1177:Ubr2 UTSW 17 47,311,692 (GRCm39) missense possibly damaging 0.76
Z1177:Ubr2 UTSW 17 47,270,435 (GRCm39) missense probably benign
Z1177:Ubr2 UTSW 17 47,321,069 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGCTGAGTCTGACCCTGATC -3'
(R):5'- ATCTACAGCAGACATCAGTGG -3'

Sequencing Primer
(F):5'- TGAGTCTGACCCTGATCTGGAGAC -3'
(R):5'- CAGCAGACATCAGTGGATATCTCTAG -3'
Posted On 2015-02-18