Incidental Mutation 'R3427:Fiz1'
ID267913
Institutional Source Beutler Lab
Gene Symbol Fiz1
Ensembl Gene ENSMUSG00000061374
Gene NameFlt3 interacting zinc finger protein 1
Synonyms
MMRRC Submission 040645-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R3427 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5007059-5014697 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5012709 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 94 (F94S)
Ref Sequence ENSEMBL: ENSMUSP00000147003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077385] [ENSMUST00000086349] [ENSMUST00000165320] [ENSMUST00000167804] [ENSMUST00000207030] [ENSMUST00000207050] [ENSMUST00000207412] [ENSMUST00000207901] [ENSMUST00000207946] [ENSMUST00000208944] [ENSMUST00000209030] [ENSMUST00000209060]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077385
AA Change: F94S

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076603
Gene: ENSMUSG00000061374
AA Change: F94S

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086349
SMART Domains Protein: ENSMUSP00000083533
Gene: ENSMUSG00000051184

DomainStartEndE-ValueType
AT_hook 29 41 1.53e2 SMART
AT_hook 51 63 1.09e0 SMART
ZnF_C2H2 109 131 1.16e-1 SMART
ZnF_C2H2 137 159 1.56e-2 SMART
ZnF_C2H2 165 187 4.4e-2 SMART
ZnF_C2H2 193 216 7.26e-3 SMART
low complexity region 272 287 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165320
AA Change: F94S

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128105
Gene: ENSMUSG00000061374
AA Change: F94S

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167804
AA Change: F94S

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126765
Gene: ENSMUSG00000061374
AA Change: F94S

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207030
AA Change: F94S

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000207050
Predicted Effect probably benign
Transcript: ENSMUST00000207412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207691
Predicted Effect probably benign
Transcript: ENSMUST00000207901
Predicted Effect probably damaging
Transcript: ENSMUST00000207946
AA Change: F94S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208944
AA Change: F94S

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000209030
Predicted Effect probably benign
Transcript: ENSMUST00000209060
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes zinc finger protein, which interacts with a receptor tyrosine kinase involved in the regulation of hematopoietic and lymphoid cells. This gene product also interacts with a transcription factor that regulates the expression of rod-specific genes in retina. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T A 9: 107,929,770 F431I probably damaging Het
Asb18 C T 1: 89,968,593 G242S probably damaging Het
Atp13a3 T C 16: 30,344,593 I582V probably benign Het
BC034090 T C 1: 155,241,498 I291M probably benign Het
Bsph1 T C 7: 13,472,243 Y78H probably damaging Het
Chd6 G T 2: 160,990,255 T999N probably damaging Het
Cps1 T A 1: 67,174,494 V795E probably damaging Het
Crhr1 A G 11: 104,173,593 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ctbp2 A T 7: 132,991,592 H793Q probably damaging Het
Cul5 T C 9: 53,617,890 M805V probably benign Het
Dctn3 T C 4: 41,719,858 K83E probably damaging Het
Ep300 A G 15: 81,601,279 N156D unknown Het
Epb42 A T 2: 121,030,039 L160M probably damaging Het
Exosc2 T C 2: 31,679,888 L237P probably damaging Het
Gm5422 A G 10: 31,248,846 noncoding transcript Het
Igsf9b T C 9: 27,334,577 F1280S probably damaging Het
Igtp G A 11: 58,206,593 V197I probably damaging Het
Kcnh1 T C 1: 192,241,930 F151L probably benign Het
Nudc C T 4: 133,534,257 G239S probably benign Het
Olfr811 T C 10: 129,801,851 K225E possibly damaging Het
Plekhb1 T C 7: 100,645,650 Y172C probably damaging Het
Plscr4 T C 9: 92,488,744 S255P probably damaging Het
Rbm26 A G 14: 105,131,532 V737A probably damaging Het
Rps6ka4 C A 19: 6,837,755 probably null Het
Rsf1 GCG GCGACGGCGTCG 7: 97,579,907 probably benign Het
Rttn G A 18: 89,095,651 probably null Het
Slc22a5 A G 11: 53,869,326 V388A probably benign Het
Strip1 T C 3: 107,616,822 H593R possibly damaging Het
Sycp1 A T 3: 102,876,350 C603S probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc1 C T 9: 95,732,196 R5Q probably benign Het
Trpv3 A T 11: 73,285,941 Y382F probably damaging Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Other mutations in Fiz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02606:Fiz1 APN 7 5009159 missense possibly damaging 0.96
R0282:Fiz1 UTSW 7 5009201 missense probably benign 0.33
R0548:Fiz1 UTSW 7 5009168 missense possibly damaging 0.86
R1693:Fiz1 UTSW 7 5008728 missense probably benign
R2054:Fiz1 UTSW 7 5008236 missense probably damaging 1.00
R2151:Fiz1 UTSW 7 5012881 missense possibly damaging 0.60
R2204:Fiz1 UTSW 7 5008686 missense probably benign 0.01
R3615:Fiz1 UTSW 7 5008172 missense probably benign 0.36
R3616:Fiz1 UTSW 7 5008172 missense probably benign 0.36
R4690:Fiz1 UTSW 7 5009168 missense probably benign 0.33
R5554:Fiz1 UTSW 7 5012850 missense probably damaging 1.00
R6340:Fiz1 UTSW 7 5008401 missense possibly damaging 0.94
R6343:Fiz1 UTSW 7 5008401 missense possibly damaging 0.94
R6586:Fiz1 UTSW 7 5008401 missense possibly damaging 0.94
R6587:Fiz1 UTSW 7 5008401 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAAGGCCTGTGTTCCATG -3'
(R):5'- TCCGTTACCGATCAGACCTG -3'

Sequencing Primer
(F):5'- CCATGTAGGGGAAATTGATCATTG -3'
(R):5'- TTACCGATCAGACCTGAGGCG -3'
Posted On2015-02-18