Incidental Mutation 'R3427:Plekhb1'
ID267917
Institutional Source Beutler Lab
Gene Symbol Plekhb1
Ensembl Gene ENSMUSG00000030701
Gene Namepleckstrin homology domain containing, family B (evectins) member 1
SynonymsPHR1, Phret1, evt-1
MMRRC Submission 040645-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3427 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location100642892-100662414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100645650 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 172 (Y172C)
Ref Sequence ENSEMBL: ENSMUSP00000115559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032946] [ENSMUST00000079176] [ENSMUST00000098252] [ENSMUST00000107043] [ENSMUST00000107044] [ENSMUST00000107045] [ENSMUST00000107046] [ENSMUST00000107047] [ENSMUST00000107048] [ENSMUST00000116287] [ENSMUST00000138830] [ENSMUST00000139708] [ENSMUST00000151123]
Predicted Effect probably benign
Transcript: ENSMUST00000032946
SMART Domains Protein: ENSMUSP00000032946
Gene: ENSMUSG00000030704

DomainStartEndE-ValueType
RAB 14 177 6.24e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079176
AA Change: Y172C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078175
Gene: ENSMUSG00000030701
AA Change: Y172C

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 216 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098252
SMART Domains Protein: ENSMUSP00000095852
Gene: ENSMUSG00000030704

DomainStartEndE-ValueType
RAB 14 177 5.52e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107043
AA Change: I105V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102658
Gene: ENSMUSG00000030701
AA Change: I105V

DomainStartEndE-ValueType
PDB:2D9V|A 2 103 1e-68 PDB
SCOP:d1dbha2 3 97 7e-12 SMART
Blast:PH 3 103 9e-67 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107044
AA Change: Y118C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102659
Gene: ENSMUSG00000030701
AA Change: Y118C

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 162 183 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107045
AA Change: Y153C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102660
Gene: ENSMUSG00000030701
AA Change: Y153C

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 197 218 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107046
AA Change: Y118C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102661
Gene: ENSMUSG00000030701
AA Change: Y118C

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 162 183 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107047
AA Change: Y137C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102662
Gene: ENSMUSG00000030701
AA Change: Y137C

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 181 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107048
SMART Domains Protein: ENSMUSP00000102663
Gene: ENSMUSG00000030704

DomainStartEndE-ValueType
RAB 1 144 2.57e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116287
AA Change: Y153C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111991
Gene: ENSMUSG00000030701
AA Change: Y153C

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 197 218 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135255
Predicted Effect probably damaging
Transcript: ENSMUST00000138830
AA Change: Y118C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116888
Gene: ENSMUSG00000030701
AA Change: Y118C

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139708
AA Change: Y118C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122333
Gene: ENSMUSG00000030701
AA Change: Y118C

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151123
AA Change: Y172C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115559
Gene: ENSMUSG00000030701
AA Change: Y172C

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 216 237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable with no abnormalities detected in growth, behavior including balance, inner ear histology, or serum and urine electrolyte concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T A 9: 107,929,770 F431I probably damaging Het
Asb18 C T 1: 89,968,593 G242S probably damaging Het
Atp13a3 T C 16: 30,344,593 I582V probably benign Het
BC034090 T C 1: 155,241,498 I291M probably benign Het
Bsph1 T C 7: 13,472,243 Y78H probably damaging Het
Chd6 G T 2: 160,990,255 T999N probably damaging Het
Cps1 T A 1: 67,174,494 V795E probably damaging Het
Crhr1 A G 11: 104,173,593 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ctbp2 A T 7: 132,991,592 H793Q probably damaging Het
Cul5 T C 9: 53,617,890 M805V probably benign Het
Dctn3 T C 4: 41,719,858 K83E probably damaging Het
Ep300 A G 15: 81,601,279 N156D unknown Het
Epb42 A T 2: 121,030,039 L160M probably damaging Het
Exosc2 T C 2: 31,679,888 L237P probably damaging Het
Fiz1 A G 7: 5,012,709 F94S probably damaging Het
Gm5422 A G 10: 31,248,846 noncoding transcript Het
Igsf9b T C 9: 27,334,577 F1280S probably damaging Het
Igtp G A 11: 58,206,593 V197I probably damaging Het
Kcnh1 T C 1: 192,241,930 F151L probably benign Het
Nudc C T 4: 133,534,257 G239S probably benign Het
Olfr811 T C 10: 129,801,851 K225E possibly damaging Het
Plscr4 T C 9: 92,488,744 S255P probably damaging Het
Rbm26 A G 14: 105,131,532 V737A probably damaging Het
Rps6ka4 C A 19: 6,837,755 probably null Het
Rsf1 GCG GCGACGGCGTCG 7: 97,579,907 probably benign Het
Rttn G A 18: 89,095,651 probably null Het
Slc22a5 A G 11: 53,869,326 V388A probably benign Het
Strip1 T C 3: 107,616,822 H593R possibly damaging Het
Sycp1 A T 3: 102,876,350 C603S probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc1 C T 9: 95,732,196 R5Q probably benign Het
Trpv3 A T 11: 73,285,941 Y382F probably damaging Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Other mutations in Plekhb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Plekhb1 APN 7 100655299 missense probably damaging 1.00
F5770:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
R0722:Plekhb1 UTSW 7 100645603 missense probably damaging 1.00
R1891:Plekhb1 UTSW 7 100655392 missense probably damaging 1.00
R5506:Plekhb1 UTSW 7 100644943 unclassified probably null
R5695:Plekhb1 UTSW 7 100655395 missense probably damaging 1.00
R5696:Plekhb1 UTSW 7 100656753 missense probably damaging 1.00
R5789:Plekhb1 UTSW 7 100645586 nonsense probably null
R6633:Plekhb1 UTSW 7 100645639 missense probably damaging 1.00
R7304:Plekhb1 UTSW 7 100645667 missense probably benign 0.19
V7580:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
V7582:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
V7583:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CCCGGAGAGTCTGTTTTGAATC -3'
(R):5'- AAGGCATTATTGGGAGCTGG -3'

Sequencing Primer
(F):5'- CTGCAAAATATGTATACCCTCAAAGG -3'
(R):5'- AGCTGGATGTTTTAGGGGAGAAG -3'
Posted On2015-02-18