Incidental Mutation 'R3427:Cul5'
ID267920
Institutional Source Beutler Lab
Gene Symbol Cul5
Ensembl Gene ENSMUSG00000032030
Gene Namecullin 5
SynonymsVACM-1, C030032G03Rik, C330021I08Rik, 8430423K24Rik, 4921514I20Rik
MMRRC Submission 040645-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3427 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location53614582-53670014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53617890 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 805 (M805V)
Ref Sequence ENSEMBL: ENSMUSP00000133144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034529] [ENSMUST00000120122] [ENSMUST00000166367]
Predicted Effect probably benign
Transcript: ENSMUST00000034529
AA Change: M832V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034529
Gene: ENSMUSG00000032030
AA Change: M832V

DomainStartEndE-ValueType
PDB:2WZK|A 76 461 N/A PDB
SCOP:d1ldja2 91 459 1e-109 SMART
CULLIN 510 661 1.12e-80 SMART
Cullin_Nedd8 782 849 5.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120122
AA Change: M628V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113490
Gene: ENSMUSG00000032030
AA Change: M628V

DomainStartEndE-ValueType
PDB:4JGH|D 1 258 N/A PDB
SCOP:d1ldja2 5 255 2e-75 SMART
CULLIN 306 457 1.12e-80 SMART
Cullin_Nedd8 578 645 5.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141803
Predicted Effect probably benign
Transcript: ENSMUST00000166367
AA Change: M805V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133144
Gene: ENSMUSG00000032030
AA Change: M805V

DomainStartEndE-ValueType
PDB:2WZK|A 76 434 N/A PDB
SCOP:d1ldja2 91 432 9e-99 SMART
CULLIN 483 634 1.12e-80 SMART
Cullin_Nedd8 755 822 5.12e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit complete embryonic lethality. Mice heterozygous for a null allele exhibit decreased susceptibility to LPS-induced lung injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T A 9: 107,929,770 F431I probably damaging Het
Asb18 C T 1: 89,968,593 G242S probably damaging Het
Atp13a3 T C 16: 30,344,593 I582V probably benign Het
BC034090 T C 1: 155,241,498 I291M probably benign Het
Bsph1 T C 7: 13,472,243 Y78H probably damaging Het
Chd6 G T 2: 160,990,255 T999N probably damaging Het
Cps1 T A 1: 67,174,494 V795E probably damaging Het
Crhr1 A G 11: 104,173,593 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ctbp2 A T 7: 132,991,592 H793Q probably damaging Het
Dctn3 T C 4: 41,719,858 K83E probably damaging Het
Ep300 A G 15: 81,601,279 N156D unknown Het
Epb42 A T 2: 121,030,039 L160M probably damaging Het
Exosc2 T C 2: 31,679,888 L237P probably damaging Het
Fiz1 A G 7: 5,012,709 F94S probably damaging Het
Gm5422 A G 10: 31,248,846 noncoding transcript Het
Igsf9b T C 9: 27,334,577 F1280S probably damaging Het
Igtp G A 11: 58,206,593 V197I probably damaging Het
Kcnh1 T C 1: 192,241,930 F151L probably benign Het
Nudc C T 4: 133,534,257 G239S probably benign Het
Olfr811 T C 10: 129,801,851 K225E possibly damaging Het
Plekhb1 T C 7: 100,645,650 Y172C probably damaging Het
Plscr4 T C 9: 92,488,744 S255P probably damaging Het
Rbm26 A G 14: 105,131,532 V737A probably damaging Het
Rps6ka4 C A 19: 6,837,755 probably null Het
Rsf1 GCG GCGACGGCGTCG 7: 97,579,907 probably benign Het
Rttn G A 18: 89,095,651 probably null Het
Slc22a5 A G 11: 53,869,326 V388A probably benign Het
Strip1 T C 3: 107,616,822 H593R possibly damaging Het
Sycp1 A T 3: 102,876,350 C603S probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc1 C T 9: 95,732,196 R5Q probably benign Het
Trpv3 A T 11: 73,285,941 Y382F probably damaging Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Other mutations in Cul5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Cul5 APN 9 53635007 missense probably damaging 1.00
IGL02043:Cul5 APN 9 53658673 missense probably benign 0.26
IGL02145:Cul5 APN 9 53635075 splice site probably benign
IGL02261:Cul5 APN 9 53635037 missense probably damaging 1.00
IGL02281:Cul5 APN 9 53635049 missense possibly damaging 0.87
IGL02639:Cul5 APN 9 53655342 missense possibly damaging 0.89
IGL02697:Cul5 APN 9 53655331 missense probably benign
IGL02752:Cul5 APN 9 53634978 missense probably damaging 0.98
IGL03017:Cul5 APN 9 53644485 critical splice donor site probably null
IGL03031:Cul5 APN 9 53642675 splice site probably benign
IGL03196:Cul5 APN 9 53625880 missense probably damaging 0.99
R0142:Cul5 UTSW 9 53635050 missense probably damaging 0.98
R0415:Cul5 UTSW 9 53667070 missense probably benign 0.00
R1619:Cul5 UTSW 9 53658593 missense probably benign 0.00
R1675:Cul5 UTSW 9 53646683 missense probably benign 0.00
R2031:Cul5 UTSW 9 53667180 missense probably benign
R2059:Cul5 UTSW 9 53667156 missense probably damaging 0.98
R3401:Cul5 UTSW 9 53621212 missense probably benign 0.02
R3701:Cul5 UTSW 9 53629216 missense probably damaging 0.99
R3702:Cul5 UTSW 9 53629216 missense probably damaging 0.99
R3815:Cul5 UTSW 9 53622943 missense probably benign 0.31
R3848:Cul5 UTSW 9 53617986 missense probably benign 0.34
R3849:Cul5 UTSW 9 53617986 missense probably benign 0.34
R3850:Cul5 UTSW 9 53617986 missense probably benign 0.34
R4592:Cul5 UTSW 9 53633727 splice site probably benign
R4690:Cul5 UTSW 9 53622871 missense probably damaging 1.00
R5154:Cul5 UTSW 9 53625867 missense probably damaging 1.00
R5173:Cul5 UTSW 9 53642734 missense probably benign
R5645:Cul5 UTSW 9 53622943 missense probably benign 0.17
R5868:Cul5 UTSW 9 53658673 missense probably benign 0.26
R5975:Cul5 UTSW 9 53622793 missense probably damaging 1.00
R6251:Cul5 UTSW 9 53646794 missense probably benign 0.40
R6284:Cul5 UTSW 9 53623735 missense probably damaging 1.00
R6415:Cul5 UTSW 9 53646683 missense probably benign 0.00
R7178:Cul5 UTSW 9 53644526 missense probably benign 0.01
R7511:Cul5 UTSW 9 53625969 missense probably damaging 1.00
X0018:Cul5 UTSW 9 53622929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTTTGTAAGGTAAGGCAGAG -3'
(R):5'- AAATGATGACCTGGGGCTGC -3'

Sequencing Primer
(F):5'- CAAATAAAGCTTCCTCCAGC -3'
(R):5'- CAGTGTGGGTGCTGTTAGAAGATAAC -3'
Posted On2015-02-18