Incidental Mutation 'R3428:Sec24d'
ID267948
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene NameSec24 related gene family, member D (S. cerevisiae)
Synonyms2310020L09Rik, LOC383951
MMRRC Submission 040646-MU
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3428 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location123267455-123365641 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 123343923 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
Predicted Effect probably benign
Transcript: ENSMUST00000047923
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197291
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 C A 8: 24,667,604 C110F probably damaging Het
Adamts14 C T 10: 61,224,374 E452K probably benign Het
Adrb3 T C 8: 27,228,181 D80G probably damaging Het
Alg5 T A 3: 54,735,585 M1K probably null Het
Ap1g1 A G 8: 109,843,448 E398G probably damaging Het
Arhgap17 A T 7: 123,323,631 L85Q probably damaging Het
Bbs9 T A 9: 22,567,887 probably benign Het
BC034090 T C 1: 155,241,498 I291M probably benign Het
Bicd1 T C 6: 149,512,902 L371P probably damaging Het
Cand2 A C 6: 115,789,707 R424S probably benign Het
Eng G T 2: 32,657,533 V29F probably damaging Het
Gm5828 T A 1: 16,768,614 noncoding transcript Het
Hspg2 T C 4: 137,555,290 L3447P probably damaging Het
Igtp G A 11: 58,206,593 V197I probably damaging Het
Kmt2a T A 9: 44,848,119 N844I probably benign Het
Lyzl4 T C 9: 121,584,129 I78V probably null Het
Mtg2 A G 2: 180,084,272 H225R possibly damaging Het
Olfr713 G A 7: 107,036,716 R187K probably benign Het
Pfpl T A 19: 12,430,313 S643T probably benign Het
Prelid1 T G 13: 55,322,194 V2G probably benign Het
Psma2 A T 13: 14,616,777 K2N probably benign Het
Setd1a G T 7: 127,785,321 probably benign Het
Slc20a1 A T 2: 129,200,282 N149I probably benign Het
Slc22a5 A G 11: 53,869,326 V388A probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav6-7-dv9 A G 14: 53,710,331 T97A probably benign Het
Trpv3 A T 11: 73,285,941 Y382F probably damaging Het
Ubr2 T C 17: 46,968,439 Y681C probably damaging Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r125 A G 4: 156,350,141 D74G probably benign Het
Yipf2 T C 9: 21,589,645 probably benign Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGAGGCTTGAAACATCAGTG -3'
(R):5'- GCTGAGCTGAAATCCAGACAAC -3'

Sequencing Primer
(F):5'- TGGACCAGATTCCTGAGA -3'
(R):5'- AGACAACATCGGCTGTTCTG -3'
Posted On2015-02-18