Incidental Mutation 'R3428:Psma2'
ID267969
Institutional Source Beutler Lab
Gene Symbol Psma2
Ensembl Gene ENSMUSG00000015671
Gene Nameproteasome (prosome, macropain) subunit, alpha type 2
SynonymsLmpc3
MMRRC Submission 040646-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R3428 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location14613240-14674236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14616777 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 2 (K2N)
Ref Sequence ENSEMBL: ENSMUSP00000152327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015816] [ENSMUST00000170836] [ENSMUST00000220621] [ENSMUST00000221168] [ENSMUST00000221699]
Predicted Effect probably benign
Transcript: ENSMUST00000015816
SMART Domains Protein: ENSMUSP00000015816
Gene: ENSMUSG00000015672

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 25 32 N/A INTRINSIC
Pfam:Ribosomal_L32p 78 135 7.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170836
AA Change: K53N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129767
Gene: ENSMUSG00000015671
AA Change: K53N

DomainStartEndE-ValueType
Proteasome_A_N 6 28 1.73e-5 SMART
Pfam:Proteasome 29 213 1.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220621
Predicted Effect probably benign
Transcript: ENSMUST00000221168
AA Change: K2N

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000221699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223530
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 C A 8: 24,667,604 C110F probably damaging Het
Adamts14 C T 10: 61,224,374 E452K probably benign Het
Adrb3 T C 8: 27,228,181 D80G probably damaging Het
Alg5 T A 3: 54,735,585 M1K probably null Het
Ap1g1 A G 8: 109,843,448 E398G probably damaging Het
Arhgap17 A T 7: 123,323,631 L85Q probably damaging Het
Bbs9 T A 9: 22,567,887 probably benign Het
BC034090 T C 1: 155,241,498 I291M probably benign Het
Bicd1 T C 6: 149,512,902 L371P probably damaging Het
Cand2 A C 6: 115,789,707 R424S probably benign Het
Eng G T 2: 32,657,533 V29F probably damaging Het
Gm5828 T A 1: 16,768,614 noncoding transcript Het
Hspg2 T C 4: 137,555,290 L3447P probably damaging Het
Igtp G A 11: 58,206,593 V197I probably damaging Het
Kmt2a T A 9: 44,848,119 N844I probably benign Het
Lyzl4 T C 9: 121,584,129 I78V probably null Het
Mtg2 A G 2: 180,084,272 H225R possibly damaging Het
Olfr713 G A 7: 107,036,716 R187K probably benign Het
Pfpl T A 19: 12,430,313 S643T probably benign Het
Prelid1 T G 13: 55,322,194 V2G probably benign Het
Sec24d C T 3: 123,343,923 probably benign Het
Setd1a G T 7: 127,785,321 probably benign Het
Slc20a1 A T 2: 129,200,282 N149I probably benign Het
Slc22a5 A G 11: 53,869,326 V388A probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav6-7-dv9 A G 14: 53,710,331 T97A probably benign Het
Trpv3 A T 11: 73,285,941 Y382F probably damaging Het
Ubr2 T C 17: 46,968,439 Y681C probably damaging Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r125 A G 4: 156,350,141 D74G probably benign Het
Yipf2 T C 9: 21,589,645 probably benign Het
Other mutations in Psma2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Psma2 APN 13 14619363 missense probably damaging 0.98
IGL02001:Psma2 APN 13 14623607 missense possibly damaging 0.90
R1245:Psma2 UTSW 13 14613291 missense probably damaging 1.00
R1801:Psma2 UTSW 13 14623605 missense probably benign 0.00
R4551:Psma2 UTSW 13 14616845 missense possibly damaging 0.69
R5068:Psma2 UTSW 13 14616028 missense probably benign 0.11
R5069:Psma2 UTSW 13 14616028 missense probably benign 0.11
R5070:Psma2 UTSW 13 14616028 missense probably benign 0.11
R5324:Psma2 UTSW 13 14625217 missense probably damaging 1.00
R7121:Psma2 UTSW 13 14625230 missense probably benign 0.39
R7853:Psma2 UTSW 13 14625247 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAATGCCTGCAGCTATGGGG -3'
(R):5'- AACTTAGCTGTCGTCAGGC -3'

Sequencing Primer
(F):5'- CCTGCAGCTATGGGGATTTTAC -3'
(R):5'- GGCTGCCATGACTCTGAAAC -3'
Posted On2015-02-18