Incidental Mutation 'R3429:Olfr1226'
ID267983
Institutional Source Beutler Lab
Gene Symbol Olfr1226
Ensembl Gene ENSMUSG00000075097
Gene Nameolfactory receptor 1226
SynonymsGA_x6K02T2Q125-50672630-50671698, MOR233-2
MMRRC Submission 040647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3429 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89188839-89200048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89193273 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 254 (I254L)
Ref Sequence ENSEMBL: ENSMUSP00000151855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099790] [ENSMUST00000214709] [ENSMUST00000215562] [ENSMUST00000215987] [ENSMUST00000216445] [ENSMUST00000217601] [ENSMUST00000220416]
Predicted Effect probably benign
Transcript: ENSMUST00000099790
AA Change: I254L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097378
Gene: ENSMUSG00000075097
AA Change: I254L

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 6.5e-47 PFAM
Pfam:7tm_1 39 285 3.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214709
AA Change: I254L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215562
AA Change: I254L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215987
AA Change: I254L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000216445
AA Change: I254L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000217601
AA Change: I254L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000220416
AA Change: I254L

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.4448 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,636,290 M1K probably null Het
Afap1l2 C A 19: 56,915,806 R683L probably damaging Het
Ankfy1 C T 11: 72,712,154 probably benign Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Asah1 C T 8: 41,351,888 probably benign Het
B4galnt4 T C 7: 141,070,839 L842P probably damaging Het
Bhmt T C 13: 93,627,347 E62G probably damaging Het
Btbd10 T A 7: 113,351,809 R25* probably null Het
Cdh5 T A 8: 104,130,968 I342N possibly damaging Het
Clca3a2 T A 3: 144,806,327 E109D probably benign Het
Cntrl T C 2: 35,145,100 L913S probably damaging Het
Col12a1 T A 9: 79,680,311 T1183S probably benign Het
Col6a6 A T 9: 105,777,967 Y852N probably damaging Het
Cpeb2 T C 5: 43,281,230 probably null Het
Cyp2c66 T A 19: 39,163,448 N202K probably damaging Het
Dchs1 A G 7: 105,756,504 V2391A possibly damaging Het
Dgat2 A G 7: 99,157,093 V299A probably benign Het
Dnah6 G A 6: 73,121,814 S2034L possibly damaging Het
E430018J23Rik T C 7: 127,391,742 T358A possibly damaging Het
Eps8l2 G A 7: 141,357,919 probably null Het
Fgg T A 3: 83,012,783 F290I probably damaging Het
Filip1 A T 9: 79,853,670 M194K probably damaging Het
Foxl2 T C 9: 98,955,982 F108L probably damaging Het
Fut1 T C 7: 45,619,374 F196L probably damaging Het
Gm10323 A C 13: 66,854,824 W17G probably damaging Het
Gstz1 T A 12: 87,163,696 probably null Het
Hacd1 T C 2: 14,044,775 probably benign Het
Hmcn2 T A 2: 31,409,144 L2834Q possibly damaging Het
Hs3st3a1 C T 11: 64,436,322 R86W probably benign Het
Krtap1-4 G C 11: 99,583,194 probably benign Het
Lmntd2 A G 7: 141,213,997 V21A probably benign Het
Lonp1 T A 17: 56,618,337 D485V probably damaging Het
Mia2 A G 12: 59,189,641 T1346A possibly damaging Het
Mpp2 T C 11: 102,085,315 T6A probably benign Het
Mycbp2 A T 14: 103,229,430 V1299E probably damaging Het
Myo1d C T 11: 80,682,410 G197E probably damaging Het
Nfib T C 4: 82,498,295 I168V possibly damaging Het
Olfr1209 C T 2: 88,909,466 R309Q probably benign Het
Olfr1391 C T 11: 49,328,041 A210V probably benign Het
Olfr1535 A T 13: 21,555,805 C72* probably null Het
Olfr318 T A 11: 58,720,271 Y259F probably damaging Het
Parp3 A T 9: 106,474,723 I150K probably damaging Het
Pnp A G 14: 50,947,986 D49G probably benign Het
Prkcq T C 2: 11,246,970 I206T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rlf A G 4: 121,150,532 L417P probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sgce T A 6: 4,730,008 D72V probably benign Het
Sh3d21 A G 4: 126,162,832 S66P probably benign Het
Sost C G 11: 101,964,039 G148A probably damaging Het
Sybu T C 15: 44,746,458 E138G probably damaging Het
Tas1r2 A G 4: 139,669,575 T742A probably damaging Het
Tet3 A G 6: 83,403,419 V589A probably damaging Het
Tnxb C A 17: 34,672,631 C649* probably null Het
Tnxb A G 17: 34,703,587 Y2458C probably damaging Het
Tsku T C 7: 98,352,539 N195S probably damaging Het
Vmn1r215 T A 13: 23,076,208 N139K probably damaging Het
Zfp106 T C 2: 120,527,063 H1117R probably benign Het
Zfp26 A G 9: 20,441,460 probably benign Het
Zfp804b T A 5: 7,180,625 probably benign Het
Zfr T C 15: 12,152,920 S546P probably benign Het
Other mutations in Olfr1226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Olfr1226 APN 2 89193504 missense probably benign 0.00
IGL01073:Olfr1226 APN 2 89193137 missense possibly damaging 0.78
IGL01539:Olfr1226 APN 2 89193492 missense possibly damaging 0.81
IGL01549:Olfr1226 APN 2 89193789 missense probably benign 0.01
IGL02040:Olfr1226 APN 2 89193563 missense probably benign 0.16
IGL02174:Olfr1226 APN 2 89193368 missense probably benign 0.01
IGL02322:Olfr1226 APN 2 89193462 missense probably damaging 0.99
IGL02881:Olfr1226 APN 2 89193641 missense probably damaging 1.00
IGL03336:Olfr1226 APN 2 89193897 missense probably benign 0.16
R1565:Olfr1226 UTSW 2 89193883 missense probably damaging 0.99
R5668:Olfr1226 UTSW 2 89193826 missense possibly damaging 0.60
R6404:Olfr1226 UTSW 2 89193562 missense probably damaging 1.00
R6418:Olfr1226 UTSW 2 89193479 missense probably damaging 0.97
R7039:Olfr1226 UTSW 2 89193446 missense probably damaging 0.96
R7863:Olfr1226 UTSW 2 89193951 missense probably benign
R8097:Olfr1226 UTSW 2 89193632 missense probably damaging 1.00
R8544:Olfr1226 UTSW 2 89193968 missense possibly damaging 0.68
R8792:Olfr1226 UTSW 2 89193887 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCACTATAAGATGCTCTTACCCAC -3'
(R):5'- GTGTTTGCCAACAGTGGGTC -3'

Sequencing Primer
(F):5'- ATAAGATGCTCTTACCCACTGGTCTG -3'
(R):5'- TGCCAACAGTGGGTCTATCTGC -3'
Posted On2015-02-18