Incidental Mutation 'R3429:Sgce'
ID267993
Institutional Source Beutler Lab
Gene Symbol Sgce
Ensembl Gene ENSMUSG00000004631
Gene Namesarcoglycan, epsilon
Synonymse-SG
MMRRC Submission 040647-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R3429 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location4674350-4747207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4730008 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 72 (D72V)
Ref Sequence ENSEMBL: ENSMUSP00000111240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004750] [ENSMUST00000090686] [ENSMUST00000101677] [ENSMUST00000115577] [ENSMUST00000115579] [ENSMUST00000126151] [ENSMUST00000133306]
Predicted Effect probably benign
Transcript: ENSMUST00000004750
SMART Domains Protein: ENSMUSP00000004750
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090686
SMART Domains Protein: ENSMUSP00000088185
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101677
SMART Domains Protein: ENSMUSP00000099200
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115577
AA Change: D72V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000111240
Gene: ENSMUSG00000004631
AA Change: D72V

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
CADG 85 193 1.86e-10 SMART
low complexity region 457 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115579
SMART Domains Protein: ENSMUSP00000111242
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123907
SMART Domains Protein: ENSMUSP00000120910
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 32 140 1.86e-10 SMART
low complexity region 395 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126151
SMART Domains Protein: ENSMUSP00000120718
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 389 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128109
Predicted Effect probably benign
Transcript: ENSMUST00000133306
SMART Domains Protein: ENSMUSP00000121964
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 398 409 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153284
Meta Mutation Damage Score 0.1209 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the epsilon member of the sarcoglycan family. Sarcoglycans are transmembrane proteins that are components of the dystrophin-glycoprotein complex, which link the actin cytoskeleton to the extracellular matrix. Unlike other family members which are predominantly expressed in striated muscle, the epsilon sarcoglycan is more broadly expressed. Mutations in this gene are associated with myoclonus-dystonia syndrome. This gene is imprinted, with preferential expression from the paternal allele. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene associated with this gene is located on chromosome 2. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele display significantly increased myoclonus and deficits in motor coordination and balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,636,290 M1K probably null Het
Afap1l2 C A 19: 56,915,806 R683L probably damaging Het
Ankfy1 C T 11: 72,712,154 probably benign Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Asah1 C T 8: 41,351,888 probably benign Het
B4galnt4 T C 7: 141,070,839 L842P probably damaging Het
Bhmt T C 13: 93,627,347 E62G probably damaging Het
Btbd10 T A 7: 113,351,809 R25* probably null Het
Cdh5 T A 8: 104,130,968 I342N possibly damaging Het
Clca3a2 T A 3: 144,806,327 E109D probably benign Het
Cntrl T C 2: 35,145,100 L913S probably damaging Het
Col12a1 T A 9: 79,680,311 T1183S probably benign Het
Col6a6 A T 9: 105,777,967 Y852N probably damaging Het
Cpeb2 T C 5: 43,281,230 probably null Het
Cyp2c66 T A 19: 39,163,448 N202K probably damaging Het
Dchs1 A G 7: 105,756,504 V2391A possibly damaging Het
Dgat2 A G 7: 99,157,093 V299A probably benign Het
Dnah6 G A 6: 73,121,814 S2034L possibly damaging Het
E430018J23Rik T C 7: 127,391,742 T358A possibly damaging Het
Eps8l2 G A 7: 141,357,919 probably null Het
Fgg T A 3: 83,012,783 F290I probably damaging Het
Filip1 A T 9: 79,853,670 M194K probably damaging Het
Foxl2 T C 9: 98,955,982 F108L probably damaging Het
Fut1 T C 7: 45,619,374 F196L probably damaging Het
Gm10323 A C 13: 66,854,824 W17G probably damaging Het
Gstz1 T A 12: 87,163,696 probably null Het
Hacd1 T C 2: 14,044,775 probably benign Het
Hmcn2 T A 2: 31,409,144 L2834Q possibly damaging Het
Hs3st3a1 C T 11: 64,436,322 R86W probably benign Het
Krtap1-4 G C 11: 99,583,194 probably benign Het
Lmntd2 A G 7: 141,213,997 V21A probably benign Het
Lonp1 T A 17: 56,618,337 D485V probably damaging Het
Mia2 A G 12: 59,189,641 T1346A possibly damaging Het
Mpp2 T C 11: 102,085,315 T6A probably benign Het
Mycbp2 A T 14: 103,229,430 V1299E probably damaging Het
Myo1d C T 11: 80,682,410 G197E probably damaging Het
Nfib T C 4: 82,498,295 I168V possibly damaging Het
Olfr1209 C T 2: 88,909,466 R309Q probably benign Het
Olfr1226 T A 2: 89,193,273 I254L probably benign Het
Olfr1391 C T 11: 49,328,041 A210V probably benign Het
Olfr1535 A T 13: 21,555,805 C72* probably null Het
Olfr318 T A 11: 58,720,271 Y259F probably damaging Het
Parp3 A T 9: 106,474,723 I150K probably damaging Het
Pnp A G 14: 50,947,986 D49G probably benign Het
Prkcq T C 2: 11,246,970 I206T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rlf A G 4: 121,150,532 L417P probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sh3d21 A G 4: 126,162,832 S66P probably benign Het
Sost C G 11: 101,964,039 G148A probably damaging Het
Sybu T C 15: 44,746,458 E138G probably damaging Het
Tas1r2 A G 4: 139,669,575 T742A probably damaging Het
Tet3 A G 6: 83,403,419 V589A probably damaging Het
Tnxb C A 17: 34,672,631 C649* probably null Het
Tnxb A G 17: 34,703,587 Y2458C probably damaging Het
Tsku T C 7: 98,352,539 N195S probably damaging Het
Vmn1r215 T A 13: 23,076,208 N139K probably damaging Het
Zfp106 T C 2: 120,527,063 H1117R probably benign Het
Zfp26 A G 9: 20,441,460 probably benign Het
Zfp804b T A 5: 7,180,625 probably benign Het
Zfr T C 15: 12,152,920 S546P probably benign Het
Other mutations in Sgce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Sgce APN 6 4689750 missense probably damaging 1.00
IGL01399:Sgce APN 6 4746997 missense probably damaging 1.00
IGL01796:Sgce APN 6 4711326 missense probably damaging 1.00
IGL02403:Sgce APN 6 4694059 missense probably damaging 1.00
IGL02421:Sgce APN 6 4694187 splice site probably benign
IGL02547:Sgce APN 6 4711301 splice site probably benign
IGL02585:Sgce APN 6 4711388 splice site probably benign
IGL03355:Sgce APN 6 4689738 missense probably damaging 1.00
IGL03374:Sgce APN 6 4689718 nonsense probably null
PIT4445001:Sgce UTSW 6 4689654 missense possibly damaging 0.85
R0345:Sgce UTSW 6 4718019 missense probably damaging 1.00
R0611:Sgce UTSW 6 4689621 missense probably damaging 1.00
R0719:Sgce UTSW 6 4689753 missense probably damaging 1.00
R1162:Sgce UTSW 6 4691419 splice site probably benign
R1630:Sgce UTSW 6 4719476 missense probably damaging 0.98
R1694:Sgce UTSW 6 4689709 missense probably damaging 1.00
R1759:Sgce UTSW 6 4689765 missense probably damaging 1.00
R1897:Sgce UTSW 6 4691511 missense probably benign 0.00
R2231:Sgce UTSW 6 4730066 missense probably benign 0.44
R4011:Sgce UTSW 6 4691563 nonsense probably null
R4426:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4427:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4651:Sgce UTSW 6 4689560 intron probably benign
R4652:Sgce UTSW 6 4689560 intron probably benign
R4921:Sgce UTSW 6 4694153 missense probably damaging 1.00
R4974:Sgce UTSW 6 4689630 missense probably benign 0.00
R6271:Sgce UTSW 6 4730015 missense possibly damaging 0.81
R6898:Sgce UTSW 6 4689666 missense probably damaging 1.00
R7317:Sgce UTSW 6 4691615 missense probably benign 0.00
R7347:Sgce UTSW 6 4694106 missense probably damaging 1.00
R7512:Sgce UTSW 6 4707192 missense possibly damaging 0.75
R7671:Sgce UTSW 6 4691564 missense probably damaging 1.00
R8009:Sgce UTSW 6 4691636 missense probably damaging 0.99
X0026:Sgce UTSW 6 4689638 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGTAAGCACACGTGAATGGTTC -3'
(R):5'- GTCTGAGAAGATGTAGTCTGAGCC -3'

Sequencing Primer
(F):5'- GCACACGTGAATGGTTCTATAAGTG -3'
(R):5'- GTCTGAGCCAAGTTAACAGTAAC -3'
Posted On2015-02-18