Mutagenetix > Incidental Mutation

Incidental Mutation 'R3429:Filip1'

268011

Institutional Source

Beutler Lab

Gene Symbol

Filip1

Ensembl Gene

ENSMUSG00000034898

Gene Name

filamin A interacting protein 1

Synonyms

5730485H21Rik

MMRRC Submission

040647-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.422) question?

Stock #

R3429 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79815051-80012851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 79853670 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 194 (M194K)

Ref Sequence

ENSEMBL: ENSMUSP00000134427 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000093811
AA Change: M194K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: M194K

Domain	Start	End	E-Value	Type
Pfam:CortBP2	71	256	2.1e-64	PFAM
coiled coil region	258	540	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	579	592	N/A	INTRINSIC
coiled coil region	625	778	N/A	INTRINSIC
low complexity region	928	940	N/A	INTRINSIC
low complexity region	1126	1140	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1198	1214	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172973
AA Change: M194K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898
AA Change: M194K

Domain	Start	End	E-Value	Type
Pfam:CortBP2	65	225	5.2e-74	PFAM

Meta Mutation Damage Score

0.7305

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,636,290	M1K	probably null	Het
Afap1l2	C	A	19: 56,915,806	R683L	probably damaging	Het
Ankfy1	C	T	11: 72,712,154		probably benign	Het
Aoc1	A	T	6: 48,906,076	E295D	probably benign	Het
Asah1	C	T	8: 41,351,888		probably benign	Het
B4galnt4	T	C	7: 141,070,839	L842P	probably damaging	Het
Bhmt	T	C	13: 93,627,347	E62G	probably damaging	Het
Btbd10	T	A	7: 113,351,809	R25*	probably null	Het
Cdh5	T	A	8: 104,130,968	I342N	possibly damaging	Het
Clca3a2	T	A	3: 144,806,327	E109D	probably benign	Het
Cntrl	T	C	2: 35,145,100	L913S	probably damaging	Het
Col12a1	T	A	9: 79,680,311	T1183S	probably benign	Het
Col6a6	A	T	9: 105,777,967	Y852N	probably damaging	Het
Cpeb2	T	C	5: 43,281,230		probably null	Het
Cyp2c66	T	A	19: 39,163,448	N202K	probably damaging	Het
Dchs1	A	G	7: 105,756,504	V2391A	possibly damaging	Het
Dgat2	A	G	7: 99,157,093	V299A	probably benign	Het
Dnah6	G	A	6: 73,121,814	S2034L	possibly damaging	Het
E430018J23Rik	T	C	7: 127,391,742	T358A	possibly damaging	Het
Eps8l2	G	A	7: 141,357,919		probably null	Het
Fgg	T	A	3: 83,012,783	F290I	probably damaging	Het
Foxl2	T	C	9: 98,955,982	F108L	probably damaging	Het
Fut1	T	C	7: 45,619,374	F196L	probably damaging	Het
Gm10323	A	C	13: 66,854,824	W17G	probably damaging	Het
Gstz1	T	A	12: 87,163,696		probably null	Het
Hacd1	T	C	2: 14,044,775		probably benign	Het
Hmcn2	T	A	2: 31,409,144	L2834Q	possibly damaging	Het
Hs3st3a1	C	T	11: 64,436,322	R86W	probably benign	Het
Krtap1-4	G	C	11: 99,583,194		probably benign	Het
Lmntd2	A	G	7: 141,213,997	V21A	probably benign	Het
Lonp1	T	A	17: 56,618,337	D485V	probably damaging	Het
Mia2	A	G	12: 59,189,641	T1346A	possibly damaging	Het
Mpp2	T	C	11: 102,085,315	T6A	probably benign	Het
Mycbp2	A	T	14: 103,229,430	V1299E	probably damaging	Het
Myo1d	C	T	11: 80,682,410	G197E	probably damaging	Het
Nfib	T	C	4: 82,498,295	I168V	possibly damaging	Het
Olfr1209	C	T	2: 88,909,466	R309Q	probably benign	Het
Olfr1226	T	A	2: 89,193,273	I254L	probably benign	Het
Olfr1391	C	T	11: 49,328,041	A210V	probably benign	Het
Olfr1535	A	T	13: 21,555,805	C72*	probably null	Het
Olfr318	T	A	11: 58,720,271	Y259F	probably damaging	Het
Parp3	A	T	9: 106,474,723	I150K	probably damaging	Het
Pnp	A	G	14: 50,947,986	D49G	probably benign	Het
Prkcq	T	C	2: 11,246,970	I206T	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rlf	A	G	4: 121,150,532	L417P	probably benign	Het
Scn7a	AT	ATT	2: 66,700,895		probably null	Het
Sgce	T	A	6: 4,730,008	D72V	probably benign	Het
Sh3d21	A	G	4: 126,162,832	S66P	probably benign	Het
Sost	C	G	11: 101,964,039	G148A	probably damaging	Het
Sybu	T	C	15: 44,746,458	E138G	probably damaging	Het
Tas1r2	A	G	4: 139,669,575	T742A	probably damaging	Het
Tet3	A	G	6: 83,403,419	V589A	probably damaging	Het
Tnxb	C	A	17: 34,672,631	C649*	probably null	Het
Tnxb	A	G	17: 34,703,587	Y2458C	probably damaging	Het
Tsku	T	C	7: 98,352,539	N195S	probably damaging	Het
Vmn1r215	T	A	13: 23,076,208	N139K	probably damaging	Het
Zfp106	T	C	2: 120,527,063	H1117R	probably benign	Het
Zfp26	A	G	9: 20,441,460		probably benign	Het
Zfp804b	T	A	5: 7,180,625		probably benign	Het
Zfr	T	C	15: 12,152,920	S546P	probably benign	Het

Other mutations in Filip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Filip1	APN	9	79817944	missense	probably damaging	1.00
IGL01101:Filip1	APN	9	79898246	missense	probably benign	0.44
IGL01301:Filip1	APN	9	79819180	missense	possibly damaging	0.93
IGL01887:Filip1	APN	9	79819617	missense	probably benign	0.42
IGL02119:Filip1	APN	9	79818266	missense	probably benign
IGL02285:Filip1	APN	9	79820126	missense	probably damaging	1.00
IGL02395:Filip1	APN	9	79898410	missense	probably benign	0.01
IGL03398:Filip1	APN	9	79818943	missense	probably benign	0.03
IGL03400:Filip1	APN	9	79820473	missense	probably benign	0.01
IGL03404:Filip1	APN	9	79818559	missense	probably damaging	0.99
ANU18:Filip1	UTSW	9	79819180	missense	possibly damaging	0.93
BB010:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
BB020:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R0101:Filip1	UTSW	9	79819528	missense	probably benign	0.04
R0243:Filip1	UTSW	9	79819003	missense	probably damaging	0.98
R0244:Filip1	UTSW	9	79819462	missense	possibly damaging	0.87
R0371:Filip1	UTSW	9	79860091	missense	probably damaging	1.00
R0399:Filip1	UTSW	9	79818310	missense	possibly damaging	0.71
R0412:Filip1	UTSW	9	79820289	missense	possibly damaging	0.59
R0671:Filip1	UTSW	9	79819390	missense	probably damaging	1.00
R1314:Filip1	UTSW	9	79820566	missense	probably damaging	1.00
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1602:Filip1	UTSW	9	79820591	missense	probably damaging	0.99
R1801:Filip1	UTSW	9	79815846	missense	probably damaging	0.98
R1929:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R1983:Filip1	UTSW	9	79860092	missense	probably damaging	1.00
R2066:Filip1	UTSW	9	79820216	missense	probably damaging	1.00
R2128:Filip1	UTSW	9	79819330	missense	probably damaging	0.99
R2271:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2411:Filip1	UTSW	9	79898433	missense	probably damaging	0.98
R3430:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3945:Filip1	UTSW	9	79818367	missense	probably benign	0.01
R4007:Filip1	UTSW	9	79818727	missense	possibly damaging	0.71
R4583:Filip1	UTSW	9	79815809	missense	possibly damaging	0.76
R4803:Filip1	UTSW	9	79820114	missense	probably benign	0.05
R4837:Filip1	UTSW	9	79819459	missense	probably damaging	0.98
R4910:Filip1	UTSW	9	79817932	missense	probably benign	0.00
R4929:Filip1	UTSW	9	79819747	missense	probably benign	0.07
R5387:Filip1	UTSW	9	79818274	missense	probably benign
R5581:Filip1	UTSW	9	79819760	missense	possibly damaging	0.95
R5808:Filip1	UTSW	9	79818701	missense	possibly damaging	0.67
R5891:Filip1	UTSW	9	79819860	missense	possibly damaging	0.69
R6166:Filip1	UTSW	9	79819454	missense	probably damaging	0.99
R6273:Filip1	UTSW	9	79815886	missense	probably benign	0.01
R6380:Filip1	UTSW	9	79819624	missense	probably damaging	0.99
R6385:Filip1	UTSW	9	79820531	missense	possibly damaging	0.68
R6614:Filip1	UTSW	9	79815839	missense	probably damaging	1.00
R6715:Filip1	UTSW	9	79818758	missense	probably benign	0.03
R7047:Filip1	UTSW	9	79853634	missense	probably damaging	0.98
R7126:Filip1	UTSW	9	79898295	missense	possibly damaging	0.88
R7144:Filip1	UTSW	9	79820213	missense	possibly damaging	0.65
R7218:Filip1	UTSW	9	79818074	missense	probably benign
R7404:Filip1	UTSW	9	79820098	missense	possibly damaging	0.94
R7702:Filip1	UTSW	9	79820649	missense	probably benign	0.20
R7866:Filip1	UTSW	9	79818943	missense	probably benign	0.03
R7933:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R8012:Filip1	UTSW	9	79817959	missense	probably damaging	0.97
R8097:Filip1	UTSW	9	79818259	missense	probably benign
R8213:Filip1	UTSW	9	79818092	missense	probably benign	0.01
R8305:Filip1	UTSW	9	79820475	nonsense	probably null
R8798:Filip1	UTSW	9	79820090	missense	possibly damaging	0.94
R9184:Filip1	UTSW	9	79898260	missense	probably benign	0.03
R9322:Filip1	UTSW	9	79819732	missense	probably benign	0.01
R9334:Filip1	UTSW	9	79818457	missense	probably benign	0.32
R9353:Filip1	UTSW	9	79818341	missense	possibly damaging	0.67
R9541:Filip1	UTSW	9	79819853	nonsense	probably null
R9607:Filip1	UTSW	9	79819120	missense	probably damaging	1.00
X0054:Filip1	UTSW	9	79819535	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCCTTTGACAGAATCCACCTTG -3'
(R):5'- TGCAGTCAGATGCTTAAACTCTTTC -3'

Sequencing Primer
(F):5'- GTTGAAGCTCTCCCATTGAAGTCAG -3'
(R):5'- AGATGCTTAAACTCTTTCCTGGC -3'

Posted On

2015-02-18