Incidental Mutation 'R3429:Filip1'
ID 268011
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Name filamin A interacting protein 1
Synonyms FILIP, 5730485H21Rik
MMRRC Submission 040647-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.499) question?
Stock # R3429 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 79712376-79920133 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79760952 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 194 (M194K)
Ref Sequence ENSEMBL: ENSMUSP00000134427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000093811
AA Change: M194K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: M194K

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172973
AA Change: M194K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898
AA Change: M194K

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Meta Mutation Damage Score 0.7305 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,613,249 (GRCm39) M1K probably null Het
Afap1l2 C A 19: 56,904,238 (GRCm39) R683L probably damaging Het
Ankfy1 C T 11: 72,602,980 (GRCm39) probably benign Het
Aoc1 A T 6: 48,883,010 (GRCm39) E295D probably benign Het
Asah1 C T 8: 41,804,925 (GRCm39) probably benign Het
B4galnt4 T C 7: 140,650,752 (GRCm39) L842P probably damaging Het
Bhmt T C 13: 93,763,855 (GRCm39) E62G probably damaging Het
Btbd10 T A 7: 112,951,016 (GRCm39) R25* probably null Het
Cdh5 T A 8: 104,857,600 (GRCm39) I342N possibly damaging Het
Clca3a2 T A 3: 144,512,088 (GRCm39) E109D probably benign Het
Cntrl T C 2: 35,035,112 (GRCm39) L913S probably damaging Het
Col12a1 T A 9: 79,587,593 (GRCm39) T1183S probably benign Het
Col6a6 A T 9: 105,655,166 (GRCm39) Y852N probably damaging Het
Cpeb2 T C 5: 43,438,573 (GRCm39) probably null Het
Cyp2c66 T A 19: 39,151,892 (GRCm39) N202K probably damaging Het
Dchs1 A G 7: 105,405,711 (GRCm39) V2391A possibly damaging Het
Dgat2 A G 7: 98,806,300 (GRCm39) V299A probably benign Het
Dnah6 G A 6: 73,098,797 (GRCm39) S2034L possibly damaging Het
Eps8l2 G A 7: 140,937,832 (GRCm39) probably null Het
Fgg T A 3: 82,920,090 (GRCm39) F290I probably damaging Het
Foxl2 T C 9: 98,838,035 (GRCm39) F108L probably damaging Het
Fut1 T C 7: 45,268,798 (GRCm39) F196L probably damaging Het
Gm10323 A C 13: 67,002,888 (GRCm39) W17G probably damaging Het
Gstz1 T A 12: 87,210,470 (GRCm39) probably null Het
Hacd1 T C 2: 14,049,586 (GRCm39) probably benign Het
Hmcn2 T A 2: 31,299,156 (GRCm39) L2834Q possibly damaging Het
Hs3st3a1 C T 11: 64,327,148 (GRCm39) R86W probably benign Het
Krtap1-4 G C 11: 99,474,020 (GRCm39) probably benign Het
Lmntd2 A G 7: 140,793,910 (GRCm39) V21A probably benign Het
Lonp1 T A 17: 56,925,337 (GRCm39) D485V probably damaging Het
Mia2 A G 12: 59,236,427 (GRCm39) T1346A possibly damaging Het
Mpp2 T C 11: 101,976,141 (GRCm39) T6A probably benign Het
Mycbp2 A T 14: 103,466,866 (GRCm39) V1299E probably damaging Het
Myo1d C T 11: 80,573,236 (GRCm39) G197E probably damaging Het
Nfib T C 4: 82,416,532 (GRCm39) I168V possibly damaging Het
Or2ak5 T A 11: 58,611,097 (GRCm39) Y259F probably damaging Het
Or2b7 A T 13: 21,739,975 (GRCm39) C72* probably null Het
Or2y1e C T 11: 49,218,868 (GRCm39) A210V probably benign Het
Or4c121 T A 2: 89,023,617 (GRCm39) I254L probably benign Het
Or4c29 C T 2: 88,739,810 (GRCm39) R309Q probably benign Het
Parp3 A T 9: 106,351,922 (GRCm39) I150K probably damaging Het
Pnp A G 14: 51,185,443 (GRCm39) D49G probably benign Het
Prkcq T C 2: 11,251,781 (GRCm39) I206T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rlf A G 4: 121,007,729 (GRCm39) L417P probably benign Het
Scn7a AT ATT 2: 66,531,239 (GRCm39) probably null Het
Sgce T A 6: 4,730,008 (GRCm39) D72V probably benign Het
Sh3d21 A G 4: 126,056,625 (GRCm39) S66P probably benign Het
Sost C G 11: 101,854,865 (GRCm39) G148A probably damaging Het
Sybu T C 15: 44,609,854 (GRCm39) E138G probably damaging Het
Tas1r2 A G 4: 139,396,886 (GRCm39) T742A probably damaging Het
Tet3 A G 6: 83,380,401 (GRCm39) V589A probably damaging Het
Tnxb C A 17: 34,891,605 (GRCm39) C649* probably null Het
Tnxb A G 17: 34,922,561 (GRCm39) Y2458C probably damaging Het
Tsku T C 7: 98,001,746 (GRCm39) N195S probably damaging Het
Vmn1r215 T A 13: 23,260,378 (GRCm39) N139K probably damaging Het
Zfp106 T C 2: 120,357,544 (GRCm39) H1117R probably benign Het
Zfp26 A G 9: 20,352,756 (GRCm39) probably benign Het
Zfp764l1 T C 7: 126,990,914 (GRCm39) T358A possibly damaging Het
Zfp804b T A 5: 7,230,625 (GRCm39) probably benign Het
Zfr T C 15: 12,153,006 (GRCm39) S546P probably benign Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79,725,226 (GRCm39) missense probably damaging 1.00
IGL01101:Filip1 APN 9 79,805,528 (GRCm39) missense probably benign 0.44
IGL01301:Filip1 APN 9 79,726,462 (GRCm39) missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79,726,899 (GRCm39) missense probably benign 0.42
IGL02119:Filip1 APN 9 79,725,548 (GRCm39) missense probably benign
IGL02285:Filip1 APN 9 79,727,408 (GRCm39) missense probably damaging 1.00
IGL02395:Filip1 APN 9 79,805,692 (GRCm39) missense probably benign 0.01
IGL03398:Filip1 APN 9 79,726,225 (GRCm39) missense probably benign 0.03
IGL03400:Filip1 APN 9 79,727,755 (GRCm39) missense probably benign 0.01
IGL03404:Filip1 APN 9 79,725,841 (GRCm39) missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79,726,462 (GRCm39) missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79,726,810 (GRCm39) missense probably benign 0.04
R0243:Filip1 UTSW 9 79,726,285 (GRCm39) missense probably damaging 0.98
R0244:Filip1 UTSW 9 79,726,744 (GRCm39) missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79,767,373 (GRCm39) missense probably damaging 1.00
R0399:Filip1 UTSW 9 79,725,592 (GRCm39) missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79,727,571 (GRCm39) missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79,726,672 (GRCm39) missense probably damaging 1.00
R1314:Filip1 UTSW 9 79,727,848 (GRCm39) missense probably damaging 1.00
R1465:Filip1 UTSW 9 79,805,589 (GRCm39) missense probably benign 0.25
R1465:Filip1 UTSW 9 79,805,589 (GRCm39) missense probably benign 0.25
R1602:Filip1 UTSW 9 79,727,873 (GRCm39) missense probably damaging 0.99
R1801:Filip1 UTSW 9 79,723,128 (GRCm39) missense probably damaging 0.98
R1929:Filip1 UTSW 9 79,727,212 (GRCm39) missense probably damaging 1.00
R1983:Filip1 UTSW 9 79,767,374 (GRCm39) missense probably damaging 1.00
R2066:Filip1 UTSW 9 79,727,498 (GRCm39) missense probably damaging 1.00
R2128:Filip1 UTSW 9 79,726,612 (GRCm39) missense probably damaging 0.99
R2271:Filip1 UTSW 9 79,727,212 (GRCm39) missense probably damaging 1.00
R2411:Filip1 UTSW 9 79,805,715 (GRCm39) missense probably damaging 0.98
R3430:Filip1 UTSW 9 79,760,952 (GRCm39) missense probably damaging 1.00
R3945:Filip1 UTSW 9 79,725,649 (GRCm39) missense probably benign 0.01
R4007:Filip1 UTSW 9 79,726,009 (GRCm39) missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79,723,091 (GRCm39) missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79,727,396 (GRCm39) missense probably benign 0.05
R4837:Filip1 UTSW 9 79,726,741 (GRCm39) missense probably damaging 0.98
R4910:Filip1 UTSW 9 79,725,214 (GRCm39) missense probably benign 0.00
R4929:Filip1 UTSW 9 79,727,029 (GRCm39) missense probably benign 0.07
R5387:Filip1 UTSW 9 79,725,556 (GRCm39) missense probably benign
R5581:Filip1 UTSW 9 79,727,042 (GRCm39) missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79,725,983 (GRCm39) missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79,727,142 (GRCm39) missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79,726,736 (GRCm39) missense probably damaging 0.99
R6273:Filip1 UTSW 9 79,723,168 (GRCm39) missense probably benign 0.01
R6380:Filip1 UTSW 9 79,726,906 (GRCm39) missense probably damaging 0.99
R6385:Filip1 UTSW 9 79,727,813 (GRCm39) missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79,723,121 (GRCm39) missense probably damaging 1.00
R6715:Filip1 UTSW 9 79,726,040 (GRCm39) missense probably benign 0.03
R7047:Filip1 UTSW 9 79,760,916 (GRCm39) missense probably damaging 0.98
R7126:Filip1 UTSW 9 79,805,577 (GRCm39) missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79,727,495 (GRCm39) missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79,725,356 (GRCm39) missense probably benign
R7404:Filip1 UTSW 9 79,727,380 (GRCm39) missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79,727,931 (GRCm39) missense probably benign 0.20
R7866:Filip1 UTSW 9 79,726,225 (GRCm39) missense probably benign 0.03
R7933:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79,725,241 (GRCm39) missense probably damaging 0.97
R8097:Filip1 UTSW 9 79,725,541 (GRCm39) missense probably benign
R8213:Filip1 UTSW 9 79,725,374 (GRCm39) missense probably benign 0.01
R8305:Filip1 UTSW 9 79,727,757 (GRCm39) nonsense probably null
R8798:Filip1 UTSW 9 79,727,372 (GRCm39) missense possibly damaging 0.94
R9184:Filip1 UTSW 9 79,805,542 (GRCm39) missense probably benign 0.03
R9322:Filip1 UTSW 9 79,727,014 (GRCm39) missense probably benign 0.01
R9334:Filip1 UTSW 9 79,725,739 (GRCm39) missense probably benign 0.32
R9353:Filip1 UTSW 9 79,725,623 (GRCm39) missense possibly damaging 0.67
R9541:Filip1 UTSW 9 79,727,135 (GRCm39) nonsense probably null
R9607:Filip1 UTSW 9 79,726,402 (GRCm39) missense probably damaging 1.00
X0054:Filip1 UTSW 9 79,726,817 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCTTTGACAGAATCCACCTTG -3'
(R):5'- TGCAGTCAGATGCTTAAACTCTTTC -3'

Sequencing Primer
(F):5'- GTTGAAGCTCTCCCATTGAAGTCAG -3'
(R):5'- AGATGCTTAAACTCTTTCCTGGC -3'
Posted On 2015-02-18