Incidental Mutation 'R3430:Bpifa6'
ID 268044
Institutional Source Beutler Lab
Gene Symbol Bpifa6
Ensembl Gene ENSMUSG00000078998
Gene Name BPI fold containing family A, member 6
Synonyms Gm5840
MMRRC Submission 040648-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R3430 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 153974945-154000495 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 153989251 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 246 (I246V)
Ref Sequence ENSEMBL: ENSMUSP00000105375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109753]
AlphaFold Q0VGU8
Predicted Effect probably benign
Transcript: ENSMUST00000109753
AA Change: I246V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105375
Gene: ENSMUSG00000078998
AA Change: I246V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:LBP_BPI_CETP 176 319 1.4e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,528,273 (GRCm38) Y114H possibly damaging Het
Afap1l2 C A 19: 56,915,806 (GRCm38) R683L probably damaging Het
Ahnak A G 19: 9,006,958 (GRCm38) I1869V probably benign Het
Aoc1 A T 6: 48,906,076 (GRCm38) E295D probably benign Het
Arhgef19 T C 4: 141,256,800 (GRCm38) L777P probably benign Het
Atf7ip A G 6: 136,575,324 (GRCm38) probably benign Het
Bhmt T C 13: 93,627,347 (GRCm38) E62G probably damaging Het
Btbd10 T A 7: 113,351,809 (GRCm38) R25* probably null Het
Ccdc88a T A 11: 29,448,033 (GRCm38) D255E probably damaging Het
Chd7 T C 4: 8,844,517 (GRCm38) V1542A probably damaging Het
Col12a1 T A 9: 79,680,311 (GRCm38) T1183S probably benign Het
Col20a1 T A 2: 181,013,285 (GRCm38) L1145* probably null Het
Dchs1 A G 7: 105,756,504 (GRCm38) V2391A possibly damaging Het
Dgat2 A G 7: 99,157,093 (GRCm38) V299A probably benign Het
Dmxl2 T A 9: 54,477,461 (GRCm38) N94I possibly damaging Het
Dnah6 G A 6: 73,121,814 (GRCm38) S2034L possibly damaging Het
Fabp3 C T 4: 130,312,387 (GRCm38) T57I probably benign Het
Filip1 A T 9: 79,853,670 (GRCm38) M194K probably damaging Het
Fut1 T C 7: 45,619,374 (GRCm38) F196L probably damaging Het
Gm10323 A C 13: 66,854,824 (GRCm38) W17G probably damaging Het
Grin3a C A 4: 49,792,534 (GRCm38) V400L probably benign Het
Htr3a T C 9: 48,907,388 (GRCm38) N82S probably benign Het
Il23r A C 6: 67,452,474 (GRCm38) S295A probably benign Het
Klk14 G A 7: 43,692,077 (GRCm38) C51Y probably damaging Het
Lama5 T C 2: 180,196,317 (GRCm38) K869E probably benign Het
Lce1d A T 3: 92,685,730 (GRCm38) probably benign Het
Lkaaear1 T C 2: 181,697,531 (GRCm38) D42G probably benign Het
Mapk8ip2 A G 15: 89,457,282 (GRCm38) E232G possibly damaging Het
Marf1 A G 16: 14,140,177 (GRCm38) probably benign Het
Mpeg1 A T 19: 12,463,128 (GRCm38) H650L probably benign Het
Nfib T C 4: 82,498,295 (GRCm38) I168V possibly damaging Het
Olfr1209 C T 2: 88,909,466 (GRCm38) R309Q probably benign Het
Olfr1507 A G 14: 52,490,425 (GRCm38) F180L possibly damaging Het
Olfr1535 A T 13: 21,555,805 (GRCm38) C72* probably null Het
Olfr389 A T 11: 73,776,539 (GRCm38) S263T probably damaging Het
Olfr918 A T 9: 38,673,139 (GRCm38) F102I probably damaging Het
Otx2 T A 14: 48,658,797 (GRCm38) K260M probably damaging Het
P2ry12 C T 3: 59,218,027 (GRCm38) D76N probably damaging Het
Parp3 A T 9: 106,474,723 (GRCm38) I150K probably damaging Het
Prex2 T G 1: 11,149,854 (GRCm38) I683S possibly damaging Het
Prss34 A T 17: 25,299,104 (GRCm38) K86I probably benign Het
Ptpn20 T A 14: 33,614,528 (GRCm38) V108D possibly damaging Het
Rlf A G 4: 121,150,532 (GRCm38) L417P probably benign Het
Rsad2 T C 12: 26,456,419 (GRCm38) M1V probably null Het
S1pr5 A G 9: 21,245,082 (GRCm38) V16A probably benign Het
Scn7a AT ATT 2: 66,700,895 (GRCm38) probably null Het
Serpinb3b A T 1: 107,154,695 (GRCm38) S280T probably benign Het
Sh3d21 A G 4: 126,162,832 (GRCm38) S66P probably benign Het
Sh3yl1 T C 12: 30,959,842 (GRCm38) S253P probably benign Het
Smarca2 A G 19: 26,691,349 (GRCm38) E916G probably damaging Het
Sptbn1 A G 11: 30,219,686 (GRCm38) I14T possibly damaging Het
Supt16 A T 14: 52,175,359 (GRCm38) M559K probably benign Het
Tas1r2 A G 4: 139,669,575 (GRCm38) T742A probably damaging Het
Tbc1d5 T C 17: 50,800,128 (GRCm38) K467E probably damaging Het
Tet3 A G 6: 83,403,419 (GRCm38) V589A probably damaging Het
Tmem131 A G 1: 36,808,821 (GRCm38) probably benign Het
Tmtc3 A G 10: 100,447,575 (GRCm38) F706S probably benign Het
Tsku T C 7: 98,352,539 (GRCm38) N195S probably damaging Het
Vmn2r85 T A 10: 130,418,889 (GRCm38) H642L probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 (GRCm38) noncoding transcript Het
Zfc3h1 A G 10: 115,410,523 (GRCm38) probably benign Het
Other mutations in Bpifa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Bpifa6 APN 2 153,990,466 (GRCm38) missense probably benign 0.00
IGL01805:Bpifa6 APN 2 153,984,912 (GRCm38) missense probably benign 0.03
IGL02246:Bpifa6 APN 2 153,989,276 (GRCm38) missense probably damaging 0.98
IGL02275:Bpifa6 APN 2 153,992,272 (GRCm38) missense probably benign 0.40
IGL02405:Bpifa6 APN 2 153,990,862 (GRCm38) nonsense probably null
IGL02587:Bpifa6 APN 2 153,989,210 (GRCm38) missense probably damaging 0.99
IGL03365:Bpifa6 APN 2 153,989,284 (GRCm38) missense possibly damaging 0.71
F6893:Bpifa6 UTSW 2 153,987,158 (GRCm38) missense probably damaging 1.00
FR4976:Bpifa6 UTSW 2 153,986,398 (GRCm38) missense probably benign
FR4976:Bpifa6 UTSW 2 153,986,376 (GRCm38) missense probably benign
R0131:Bpifa6 UTSW 2 153,982,931 (GRCm38) missense probably benign 0.11
R0131:Bpifa6 UTSW 2 153,982,931 (GRCm38) missense probably benign 0.11
R0132:Bpifa6 UTSW 2 153,982,931 (GRCm38) missense probably benign 0.11
R0799:Bpifa6 UTSW 2 153,992,272 (GRCm38) missense probably benign 0.40
R1468:Bpifa6 UTSW 2 153,989,272 (GRCm38) missense probably benign 0.01
R1468:Bpifa6 UTSW 2 153,989,272 (GRCm38) missense probably benign 0.01
R1767:Bpifa6 UTSW 2 153,987,227 (GRCm38) missense possibly damaging 0.95
R2255:Bpifa6 UTSW 2 153,990,895 (GRCm38) missense probably damaging 0.98
R2857:Bpifa6 UTSW 2 153,989,274 (GRCm38) missense probably benign 0.03
R4616:Bpifa6 UTSW 2 153,982,988 (GRCm38) missense possibly damaging 0.47
R5420:Bpifa6 UTSW 2 153,989,330 (GRCm38) missense probably damaging 0.98
R6224:Bpifa6 UTSW 2 153,987,153 (GRCm38) missense probably damaging 0.99
R6483:Bpifa6 UTSW 2 153,990,434 (GRCm38) missense probably benign 0.13
R6552:Bpifa6 UTSW 2 153,987,158 (GRCm38) missense probably damaging 0.99
R7061:Bpifa6 UTSW 2 153,992,316 (GRCm38) missense probably benign 0.00
R7378:Bpifa6 UTSW 2 153,986,433 (GRCm38) missense probably damaging 0.99
R7472:Bpifa6 UTSW 2 153,989,329 (GRCm38) missense possibly damaging 0.93
R8313:Bpifa6 UTSW 2 153,989,258 (GRCm38) nonsense probably null
R9193:Bpifa6 UTSW 2 153,984,820 (GRCm38) missense probably benign 0.38
R9309:Bpifa6 UTSW 2 153,992,287 (GRCm38) missense probably benign 0.03
R9316:Bpifa6 UTSW 2 153,986,463 (GRCm38) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTATGTGTATCAGTTACCTCTCAGC -3'
(R):5'- AGGGCATTAAAACACTAGTGGC -3'

Sequencing Primer
(F):5'- GCCATAAATGCCCAGACCTGTTTG -3'
(R):5'- GATTCCATGGAGCCTGATAACTAC -3'
Posted On 2015-02-18