Incidental Mutation 'R3430:Dgat2'
ID268067
Institutional Source Beutler Lab
Gene Symbol Dgat2
Ensembl Gene ENSMUSG00000030747
Gene Namediacylglycerol O-acyltransferase 2
Synonyms
MMRRC Submission 040648-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3430 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99153658-99182719 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99157093 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 299 (V299A)
Ref Sequence ENSEMBL: ENSMUSP00000033001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033001] [ENSMUST00000207491] [ENSMUST00000208591]
Predicted Effect probably benign
Transcript: ENSMUST00000033001
AA Change: V299A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000033001
Gene: ENSMUSG00000030747
AA Change: V299A

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Pfam:DAGAT 92 388 5.3e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207894
Predicted Effect probably benign
Transcript: ENSMUST00000208591
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two enzymes which catalyzes the final reaction in the synthesis of triglycerides in which diacylglycerol is covalently bound to long chain fatty acyl-CoAs. The encoded protein catalyzes this reaction at low concentrations of magnesium chloride while the other enzyme has high activity at high concentrations of magnesium chloride. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutant mice die shortly after birth due to inadequate substrates for energy and impaired skin barrier function leading to dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,528,273 Y114H possibly damaging Het
Afap1l2 C A 19: 56,915,806 R683L probably damaging Het
Ahnak A G 19: 9,006,958 I1869V probably benign Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arhgef19 T C 4: 141,256,800 L777P probably benign Het
Atf7ip A G 6: 136,575,324 probably benign Het
Bhmt T C 13: 93,627,347 E62G probably damaging Het
Bpifa6 A G 2: 153,989,251 I246V probably benign Het
Btbd10 T A 7: 113,351,809 R25* probably null Het
Ccdc88a T A 11: 29,448,033 D255E probably damaging Het
Chd7 T C 4: 8,844,517 V1542A probably damaging Het
Col12a1 T A 9: 79,680,311 T1183S probably benign Het
Col20a1 T A 2: 181,013,285 L1145* probably null Het
Dchs1 A G 7: 105,756,504 V2391A possibly damaging Het
Dmxl2 T A 9: 54,477,461 N94I possibly damaging Het
Dnah6 G A 6: 73,121,814 S2034L possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Filip1 A T 9: 79,853,670 M194K probably damaging Het
Fut1 T C 7: 45,619,374 F196L probably damaging Het
Gm10323 A C 13: 66,854,824 W17G probably damaging Het
Grin3a C A 4: 49,792,534 V400L probably benign Het
Htr3a T C 9: 48,907,388 N82S probably benign Het
Il23r A C 6: 67,452,474 S295A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama5 T C 2: 180,196,317 K869E probably benign Het
Lce1d A T 3: 92,685,730 probably benign Het
Lkaaear1 T C 2: 181,697,531 D42G probably benign Het
Mapk8ip2 A G 15: 89,457,282 E232G possibly damaging Het
Marf1 A G 16: 14,140,177 probably benign Het
Mpeg1 A T 19: 12,463,128 H650L probably benign Het
Nfib T C 4: 82,498,295 I168V possibly damaging Het
Olfr1209 C T 2: 88,909,466 R309Q probably benign Het
Olfr1507 A G 14: 52,490,425 F180L possibly damaging Het
Olfr1535 A T 13: 21,555,805 C72* probably null Het
Olfr389 A T 11: 73,776,539 S263T probably damaging Het
Olfr918 A T 9: 38,673,139 F102I probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
P2ry12 C T 3: 59,218,027 D76N probably damaging Het
Parp3 A T 9: 106,474,723 I150K probably damaging Het
Prex2 T G 1: 11,149,854 I683S possibly damaging Het
Prss34 A T 17: 25,299,104 K86I probably benign Het
Ptpn20 T A 14: 33,614,528 V108D possibly damaging Het
Rlf A G 4: 121,150,532 L417P probably benign Het
Rsad2 T C 12: 26,456,419 M1V probably null Het
S1pr5 A G 9: 21,245,082 V16A probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Serpinb3b A T 1: 107,154,695 S280T probably benign Het
Sh3d21 A G 4: 126,162,832 S66P probably benign Het
Sh3yl1 T C 12: 30,959,842 S253P probably benign Het
Smarca2 A G 19: 26,691,349 E916G probably damaging Het
Sptbn1 A G 11: 30,219,686 I14T possibly damaging Het
Supt16 A T 14: 52,175,359 M559K probably benign Het
Tas1r2 A G 4: 139,669,575 T742A probably damaging Het
Tbc1d5 T C 17: 50,800,128 K467E probably damaging Het
Tet3 A G 6: 83,403,419 V589A probably damaging Het
Tmem131 A G 1: 36,808,821 probably benign Het
Tmtc3 A G 10: 100,447,575 F706S probably benign Het
Tsku T C 7: 98,352,539 N195S probably damaging Het
Vmn2r85 T A 10: 130,418,889 H642L probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfc3h1 A G 10: 115,410,523 probably benign Het
Other mutations in Dgat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4377001:Dgat2 UTSW 7 99157135 missense probably damaging 1.00
R0532:Dgat2 UTSW 7 99169781 missense possibly damaging 0.46
R1726:Dgat2 UTSW 7 99182416 missense possibly damaging 0.83
R2386:Dgat2 UTSW 7 99157093 missense possibly damaging 0.79
R3429:Dgat2 UTSW 7 99157093 missense probably benign 0.05
R3881:Dgat2 UTSW 7 99169743 nonsense probably null
R4279:Dgat2 UTSW 7 99164705 missense probably damaging 1.00
R4280:Dgat2 UTSW 7 99158997 missense probably damaging 1.00
R4719:Dgat2 UTSW 7 99158297 missense probably benign 0.01
R6019:Dgat2 UTSW 7 99154631 missense probably benign 0.13
R6152:Dgat2 UTSW 7 99164678 missense probably benign 0.20
R6868:Dgat2 UTSW 7 99158306 missense probably benign 0.00
R7143:Dgat2 UTSW 7 99157124 missense probably benign 0.00
R7362:Dgat2 UTSW 7 99154636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGGATGTTCTCTGAGCTGG -3'
(R):5'- CCATGAGGTGAATCTGTGCC -3'

Sequencing Primer
(F):5'- GGTGACCGGCTATGCTCAG -3'
(R):5'- AATCTGTGCCTGTGAGGAAG -3'
Posted On2015-02-18