Incidental Mutation 'R3430:Olfr918'
ID268070
Institutional Source Beutler Lab
Gene Symbol Olfr918
Ensembl Gene ENSMUSG00000046150
Gene Nameolfactory receptor 918
SynonymsGA_x6K02T2PVTD-32375756-32374818, MOR164-3
MMRRC Submission 040648-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R3430 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38669861-38674601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38673139 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 102 (F102I)
Ref Sequence ENSEMBL: ENSMUSP00000150182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055099] [ENSMUST00000215461]
Predicted Effect probably damaging
Transcript: ENSMUST00000055099
AA Change: F115I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057210
Gene: ENSMUSG00000046150
AA Change: F115I

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:7tm_4 44 319 6.5e-48 PFAM
Pfam:7tm_1 54 301 3.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213750
Predicted Effect probably damaging
Transcript: ENSMUST00000215461
AA Change: F102I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216579
Meta Mutation Damage Score 0.1861 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,528,273 Y114H possibly damaging Het
Afap1l2 C A 19: 56,915,806 R683L probably damaging Het
Ahnak A G 19: 9,006,958 I1869V probably benign Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arhgef19 T C 4: 141,256,800 L777P probably benign Het
Atf7ip A G 6: 136,575,324 probably benign Het
Bhmt T C 13: 93,627,347 E62G probably damaging Het
Bpifa6 A G 2: 153,989,251 I246V probably benign Het
Btbd10 T A 7: 113,351,809 R25* probably null Het
Ccdc88a T A 11: 29,448,033 D255E probably damaging Het
Chd7 T C 4: 8,844,517 V1542A probably damaging Het
Col12a1 T A 9: 79,680,311 T1183S probably benign Het
Col20a1 T A 2: 181,013,285 L1145* probably null Het
Dchs1 A G 7: 105,756,504 V2391A possibly damaging Het
Dgat2 A G 7: 99,157,093 V299A probably benign Het
Dmxl2 T A 9: 54,477,461 N94I possibly damaging Het
Dnah6 G A 6: 73,121,814 S2034L possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Filip1 A T 9: 79,853,670 M194K probably damaging Het
Fut1 T C 7: 45,619,374 F196L probably damaging Het
Gm10323 A C 13: 66,854,824 W17G probably damaging Het
Grin3a C A 4: 49,792,534 V400L probably benign Het
Htr3a T C 9: 48,907,388 N82S probably benign Het
Il23r A C 6: 67,452,474 S295A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama5 T C 2: 180,196,317 K869E probably benign Het
Lce1d A T 3: 92,685,730 probably benign Het
Lkaaear1 T C 2: 181,697,531 D42G probably benign Het
Mapk8ip2 A G 15: 89,457,282 E232G possibly damaging Het
Marf1 A G 16: 14,140,177 probably benign Het
Mpeg1 A T 19: 12,463,128 H650L probably benign Het
Nfib T C 4: 82,498,295 I168V possibly damaging Het
Olfr1209 C T 2: 88,909,466 R309Q probably benign Het
Olfr1507 A G 14: 52,490,425 F180L possibly damaging Het
Olfr1535 A T 13: 21,555,805 C72* probably null Het
Olfr389 A T 11: 73,776,539 S263T probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
P2ry12 C T 3: 59,218,027 D76N probably damaging Het
Parp3 A T 9: 106,474,723 I150K probably damaging Het
Prex2 T G 1: 11,149,854 I683S possibly damaging Het
Prss34 A T 17: 25,299,104 K86I probably benign Het
Ptpn20 T A 14: 33,614,528 V108D possibly damaging Het
Rlf A G 4: 121,150,532 L417P probably benign Het
Rsad2 T C 12: 26,456,419 M1V probably null Het
S1pr5 A G 9: 21,245,082 V16A probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Serpinb3b A T 1: 107,154,695 S280T probably benign Het
Sh3d21 A G 4: 126,162,832 S66P probably benign Het
Sh3yl1 T C 12: 30,959,842 S253P probably benign Het
Smarca2 A G 19: 26,691,349 E916G probably damaging Het
Sptbn1 A G 11: 30,219,686 I14T possibly damaging Het
Supt16 A T 14: 52,175,359 M559K probably benign Het
Tas1r2 A G 4: 139,669,575 T742A probably damaging Het
Tbc1d5 T C 17: 50,800,128 K467E probably damaging Het
Tet3 A G 6: 83,403,419 V589A probably damaging Het
Tmem131 A G 1: 36,808,821 probably benign Het
Tmtc3 A G 10: 100,447,575 F706S probably benign Het
Tsku T C 7: 98,352,539 N195S probably damaging Het
Vmn2r85 T A 10: 130,418,889 H642L probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfc3h1 A G 10: 115,410,523 probably benign Het
Other mutations in Olfr918
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr918 APN 9 38673024 missense probably benign 0.01
IGL01388:Olfr918 APN 9 38673083 nonsense probably null
IGL01516:Olfr918 APN 9 38672863 missense probably benign 0.09
IGL02121:Olfr918 APN 9 38673415 missense probably damaging 0.98
IGL02209:Olfr918 APN 9 38673046 missense possibly damaging 0.84
IGL02256:Olfr918 APN 9 38673480 start codon destroyed probably null
IGL02517:Olfr918 APN 9 38672913 missense probably damaging 1.00
IGL02648:Olfr918 APN 9 38673016 missense probably benign
IGL02747:Olfr918 APN 9 38673084 missense probably benign 0.11
IGL02971:Olfr918 APN 9 38673268 missense probably damaging 0.96
E0370:Olfr918 UTSW 9 38672561 missense probably damaging 0.99
R0616:Olfr918 UTSW 9 38673480 start codon destroyed probably null
R2173:Olfr918 UTSW 9 38672944 missense probably benign 0.03
R2989:Olfr918 UTSW 9 38672535 missense probably benign
R3809:Olfr918 UTSW 9 38672863 missense probably benign 0.09
R4688:Olfr918 UTSW 9 38673363 missense probably damaging 1.00
R4702:Olfr918 UTSW 9 38673480 start codon destroyed probably null
R5548:Olfr918 UTSW 9 38673304 missense probably benign 0.00
R5590:Olfr918 UTSW 9 38672965 missense probably damaging 1.00
R6082:Olfr918 UTSW 9 38672570 missense probably damaging 1.00
R6214:Olfr918 UTSW 9 38673214 missense probably benign 0.13
R6215:Olfr918 UTSW 9 38673214 missense probably benign 0.13
R6893:Olfr918 UTSW 9 38673059 missense possibly damaging 0.95
R7215:Olfr918 UTSW 9 38673447 missense probably benign 0.05
R7624:Olfr918 UTSW 9 38672623 missense probably benign 0.18
R7862:Olfr918 UTSW 9 38673328 missense probably benign 0.01
R7945:Olfr918 UTSW 9 38673328 missense probably benign 0.01
R8116:Olfr918 UTSW 9 38673168 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACATTGGCATTGCAGAAGATCAG -3'
(R):5'- TGGGAAACTTGGGCTTGATC -3'

Sequencing Primer
(F):5'- ATCAGTCGGAGCATGCAGC -3'
(R):5'- AAACTTGGGCTTGATCATCCTG -3'
Posted On2015-02-18