Incidental Mutation 'R3430:Ptpn20'
ID268088
Institutional Source Beutler Lab
Gene Symbol Ptpn20
Ensembl Gene ENSMUSG00000021940
Gene Nameprotein tyrosine phosphatase, non-receptor type 20
Synonymstyp
MMRRC Submission 040648-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3430 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33589207-33640754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33614528 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 108 (V108D)
Ref Sequence ENSEMBL: ENSMUSP00000153829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022508] [ENSMUST00000226512] [ENSMUST00000227887]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022508
AA Change: V108D

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022508
Gene: ENSMUSG00000021940
AA Change: V108D

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PTPc 164 420 1.12e-120 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000226512
AA Change: V108D

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000227887
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes. The encoded protein appears to be targeted to sites of actin polymerization. A pseudogene of this gene has been defined on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,528,273 Y114H possibly damaging Het
Afap1l2 C A 19: 56,915,806 R683L probably damaging Het
Ahnak A G 19: 9,006,958 I1869V probably benign Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arhgef19 T C 4: 141,256,800 L777P probably benign Het
Atf7ip A G 6: 136,575,324 probably benign Het
Bhmt T C 13: 93,627,347 E62G probably damaging Het
Bpifa6 A G 2: 153,989,251 I246V probably benign Het
Btbd10 T A 7: 113,351,809 R25* probably null Het
Ccdc88a T A 11: 29,448,033 D255E probably damaging Het
Chd7 T C 4: 8,844,517 V1542A probably damaging Het
Col12a1 T A 9: 79,680,311 T1183S probably benign Het
Col20a1 T A 2: 181,013,285 L1145* probably null Het
Dchs1 A G 7: 105,756,504 V2391A possibly damaging Het
Dgat2 A G 7: 99,157,093 V299A probably benign Het
Dmxl2 T A 9: 54,477,461 N94I possibly damaging Het
Dnah6 G A 6: 73,121,814 S2034L possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Filip1 A T 9: 79,853,670 M194K probably damaging Het
Fut1 T C 7: 45,619,374 F196L probably damaging Het
Gm10323 A C 13: 66,854,824 W17G probably damaging Het
Grin3a C A 4: 49,792,534 V400L probably benign Het
Htr3a T C 9: 48,907,388 N82S probably benign Het
Il23r A C 6: 67,452,474 S295A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama5 T C 2: 180,196,317 K869E probably benign Het
Lce1d A T 3: 92,685,730 probably benign Het
Lkaaear1 T C 2: 181,697,531 D42G probably benign Het
Mapk8ip2 A G 15: 89,457,282 E232G possibly damaging Het
Marf1 A G 16: 14,140,177 probably benign Het
Mpeg1 A T 19: 12,463,128 H650L probably benign Het
Nfib T C 4: 82,498,295 I168V possibly damaging Het
Olfr1209 C T 2: 88,909,466 R309Q probably benign Het
Olfr1507 A G 14: 52,490,425 F180L possibly damaging Het
Olfr1535 A T 13: 21,555,805 C72* probably null Het
Olfr389 A T 11: 73,776,539 S263T probably damaging Het
Olfr918 A T 9: 38,673,139 F102I probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
P2ry12 C T 3: 59,218,027 D76N probably damaging Het
Parp3 A T 9: 106,474,723 I150K probably damaging Het
Prex2 T G 1: 11,149,854 I683S possibly damaging Het
Prss34 A T 17: 25,299,104 K86I probably benign Het
Rlf A G 4: 121,150,532 L417P probably benign Het
Rsad2 T C 12: 26,456,419 M1V probably null Het
S1pr5 A G 9: 21,245,082 V16A probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Serpinb3b A T 1: 107,154,695 S280T probably benign Het
Sh3d21 A G 4: 126,162,832 S66P probably benign Het
Sh3yl1 T C 12: 30,959,842 S253P probably benign Het
Smarca2 A G 19: 26,691,349 E916G probably damaging Het
Sptbn1 A G 11: 30,219,686 I14T possibly damaging Het
Supt16 A T 14: 52,175,359 M559K probably benign Het
Tas1r2 A G 4: 139,669,575 T742A probably damaging Het
Tbc1d5 T C 17: 50,800,128 K467E probably damaging Het
Tet3 A G 6: 83,403,419 V589A probably damaging Het
Tmem131 A G 1: 36,808,821 probably benign Het
Tmtc3 A G 10: 100,447,575 F706S probably benign Het
Tsku T C 7: 98,352,539 N195S probably damaging Het
Vmn2r85 T A 10: 130,418,889 H642L probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfc3h1 A G 10: 115,410,523 probably benign Het
Other mutations in Ptpn20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ptpn20 APN 14 33622619 missense probably benign 0.22
IGL01510:Ptpn20 APN 14 33638386 splice site probably null
R2057:Ptpn20 UTSW 14 33630985 missense probably damaging 0.98
R2262:Ptpn20 UTSW 14 33612311 missense probably benign
R3106:Ptpn20 UTSW 14 33612296 missense probably benign
R4645:Ptpn20 UTSW 14 33631212 missense probably benign
R4928:Ptpn20 UTSW 14 33614489 missense probably benign 0.00
R4962:Ptpn20 UTSW 14 33614459 missense probably benign 0.02
R5087:Ptpn20 UTSW 14 33614441 missense possibly damaging 0.90
R5163:Ptpn20 UTSW 14 33631111 missense probably benign 0.07
R5275:Ptpn20 UTSW 14 33631192 missense probably benign 0.00
R6325:Ptpn20 UTSW 14 33631005 missense possibly damaging 0.52
R6651:Ptpn20 UTSW 14 33632940 missense probably damaging 1.00
R6831:Ptpn20 UTSW 14 33632925 missense probably damaging 1.00
R6903:Ptpn20 UTSW 14 33614504 missense probably damaging 0.98
R7034:Ptpn20 UTSW 14 33614435 makesense probably null
R7036:Ptpn20 UTSW 14 33614435 makesense probably null
R7265:Ptpn20 UTSW 14 33614524 missense probably benign 0.05
R7654:Ptpn20 UTSW 14 33638324 missense probably benign 0.18
R7735:Ptpn20 UTSW 14 33630945 missense probably damaging 1.00
R7761:Ptpn20 UTSW 14 33622552 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CAGGATATGCAGTTTGTGATCAG -3'
(R):5'- TTCCAGCAACAGGGAGAATG -3'

Sequencing Primer
(F):5'- ATCAGGTGTTAAATTTAGAGTTACCC -3'
(R):5'- TGCCTTAATAAAATCCA -3'
Posted On2015-02-18