Incidental Mutation 'R3430:Supt16'
ID 268090
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name suppressor of Ty 16
Synonyms Supt16h, Spt16, Fact140, Cdc68
MMRRC Submission 040648-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R3430 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 52160414-52197416 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52175359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 559 (M559K)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046709
AA Change: M559K

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: M559K

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.0659 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,528,273 Y114H possibly damaging Het
Afap1l2 C A 19: 56,915,806 R683L probably damaging Het
Ahnak A G 19: 9,006,958 I1869V probably benign Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arhgef19 T C 4: 141,256,800 L777P probably benign Het
Atf7ip A G 6: 136,575,324 probably benign Het
Bhmt T C 13: 93,627,347 E62G probably damaging Het
Bpifa6 A G 2: 153,989,251 I246V probably benign Het
Btbd10 T A 7: 113,351,809 R25* probably null Het
Ccdc88a T A 11: 29,448,033 D255E probably damaging Het
Chd7 T C 4: 8,844,517 V1542A probably damaging Het
Col12a1 T A 9: 79,680,311 T1183S probably benign Het
Col20a1 T A 2: 181,013,285 L1145* probably null Het
Dchs1 A G 7: 105,756,504 V2391A possibly damaging Het
Dgat2 A G 7: 99,157,093 V299A probably benign Het
Dmxl2 T A 9: 54,477,461 N94I possibly damaging Het
Dnah6 G A 6: 73,121,814 S2034L possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Filip1 A T 9: 79,853,670 M194K probably damaging Het
Fut1 T C 7: 45,619,374 F196L probably damaging Het
Gm10323 A C 13: 66,854,824 W17G probably damaging Het
Grin3a C A 4: 49,792,534 V400L probably benign Het
Htr3a T C 9: 48,907,388 N82S probably benign Het
Il23r A C 6: 67,452,474 S295A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama5 T C 2: 180,196,317 K869E probably benign Het
Lce1d A T 3: 92,685,730 probably benign Het
Lkaaear1 T C 2: 181,697,531 D42G probably benign Het
Mapk8ip2 A G 15: 89,457,282 E232G possibly damaging Het
Marf1 A G 16: 14,140,177 probably benign Het
Mpeg1 A T 19: 12,463,128 H650L probably benign Het
Nfib T C 4: 82,498,295 I168V possibly damaging Het
Olfr1209 C T 2: 88,909,466 R309Q probably benign Het
Olfr1507 A G 14: 52,490,425 F180L possibly damaging Het
Olfr1535 A T 13: 21,555,805 C72* probably null Het
Olfr389 A T 11: 73,776,539 S263T probably damaging Het
Olfr918 A T 9: 38,673,139 F102I probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
P2ry12 C T 3: 59,218,027 D76N probably damaging Het
Parp3 A T 9: 106,474,723 I150K probably damaging Het
Prex2 T G 1: 11,149,854 I683S possibly damaging Het
Prss34 A T 17: 25,299,104 K86I probably benign Het
Ptpn20 T A 14: 33,614,528 V108D possibly damaging Het
Rlf A G 4: 121,150,532 L417P probably benign Het
Rsad2 T C 12: 26,456,419 M1V probably null Het
S1pr5 A G 9: 21,245,082 V16A probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Serpinb3b A T 1: 107,154,695 S280T probably benign Het
Sh3d21 A G 4: 126,162,832 S66P probably benign Het
Sh3yl1 T C 12: 30,959,842 S253P probably benign Het
Smarca2 A G 19: 26,691,349 E916G probably damaging Het
Sptbn1 A G 11: 30,219,686 I14T possibly damaging Het
Tas1r2 A G 4: 139,669,575 T742A probably damaging Het
Tbc1d5 T C 17: 50,800,128 K467E probably damaging Het
Tet3 A G 6: 83,403,419 V589A probably damaging Het
Tmem131 A G 1: 36,808,821 probably benign Het
Tmtc3 A G 10: 100,447,575 F706S probably benign Het
Tsku T C 7: 98,352,539 N195S probably damaging Het
Vmn2r85 T A 10: 130,418,889 H642L probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfc3h1 A G 10: 115,410,523 probably benign Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8797:Supt16 UTSW 14 52172503 missense probably damaging 0.99
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
R9048:Supt16 UTSW 14 52181056 missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- TCTTGTGAAAGGATGTAGCAGG -3'
(R):5'- AGGAACAGCAAACTCTGGCC -3'

Sequencing Primer
(F):5'- ATGGACATGTGAGGTCATTGCAC -3'
(R):5'- GAACAGCAAACTCTGGCCTTTTTC -3'
Posted On 2015-02-18