Incidental Mutation 'R3430:Marf1'
ID 268093
Institutional Source Beutler Lab
Gene Symbol Marf1
Ensembl Gene ENSMUSG00000060657
Gene Name meiosis regulator and mRNA stability 1
Synonyms 4921513D23Rik
MMRRC Submission 040648-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R3430 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 13927030-13977157 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 13958041 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090300] [ENSMUST00000229614]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000090300
SMART Domains Protein: ENSMUSP00000087770
Gene: ENSMUSG00000060657

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
Pfam:NYN 351 492 1.5e-21 PFAM
RRM 511 579 3.17e-1 SMART
low complexity region 599 610 N/A INTRINSIC
RRM 790 864 4.47e-3 SMART
internal_repeat_2 871 914 1.57e-5 PROSPERO
low complexity region 944 960 N/A INTRINSIC
Pfam:OST-HTH 1096 1167 1e-11 PFAM
low complexity region 1181 1186 N/A INTRINSIC
Pfam:OST-HTH 1256 1328 1.2e-10 PFAM
Pfam:OST-HTH 1332 1404 2.4e-10 PFAM
Pfam:OST-HTH 1408 1480 6.8e-13 PFAM
Pfam:OST-HTH 1483 1555 3e-14 PFAM
low complexity region 1682 1701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231032
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative peroxisomal protein that appears to be conserved across Euteleostomi. In humans, it may be autoantigenic. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit female infertility with abnormalities in oogenic processes including meiotic progression, genomic integrity and acquisition of developmental competence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 C A 19: 56,904,238 (GRCm39) R683L probably damaging Het
Ahnak A G 19: 8,984,322 (GRCm39) I1869V probably benign Het
Aoc1 A T 6: 48,883,010 (GRCm39) E295D probably benign Het
Arhgef19 T C 4: 140,984,111 (GRCm39) L777P probably benign Het
Atf7ip A G 6: 136,552,322 (GRCm39) probably benign Het
Bhmt T C 13: 93,763,855 (GRCm39) E62G probably damaging Het
Bpifa6 A G 2: 153,831,171 (GRCm39) I246V probably benign Het
Btbd10 T A 7: 112,951,016 (GRCm39) R25* probably null Het
Ccdc88a T A 11: 29,398,033 (GRCm39) D255E probably damaging Het
Chd7 T C 4: 8,844,517 (GRCm39) V1542A probably damaging Het
Cimip1 T C 2: 173,370,066 (GRCm39) Y114H possibly damaging Het
Col12a1 T A 9: 79,587,593 (GRCm39) T1183S probably benign Het
Col20a1 T A 2: 180,655,078 (GRCm39) L1145* probably null Het
Dchs1 A G 7: 105,405,711 (GRCm39) V2391A possibly damaging Het
Dgat2 A G 7: 98,806,300 (GRCm39) V299A probably benign Het
Dmxl2 T A 9: 54,384,745 (GRCm39) N94I possibly damaging Het
Dnah6 G A 6: 73,098,797 (GRCm39) S2034L possibly damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Filip1 A T 9: 79,760,952 (GRCm39) M194K probably damaging Het
Fut1 T C 7: 45,268,798 (GRCm39) F196L probably damaging Het
Gm10323 A C 13: 67,002,888 (GRCm39) W17G probably damaging Het
Grin3a C A 4: 49,792,534 (GRCm39) V400L probably benign Het
Htr3a T C 9: 48,818,688 (GRCm39) N82S probably benign Het
Il23r A C 6: 67,429,458 (GRCm39) S295A probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lama5 T C 2: 179,838,110 (GRCm39) K869E probably benign Het
Lce1d A T 3: 92,593,037 (GRCm39) probably benign Het
Lkaaear1 T C 2: 181,339,324 (GRCm39) D42G probably benign Het
Mapk8ip2 A G 15: 89,341,485 (GRCm39) E232G possibly damaging Het
Mpeg1 A T 19: 12,440,492 (GRCm39) H650L probably benign Het
Nfib T C 4: 82,416,532 (GRCm39) I168V possibly damaging Het
Or1e29 A T 11: 73,667,365 (GRCm39) S263T probably damaging Het
Or2b7 A T 13: 21,739,975 (GRCm39) C72* probably null Het
Or4c29 C T 2: 88,739,810 (GRCm39) R309Q probably benign Het
Or4e5 A G 14: 52,727,882 (GRCm39) F180L possibly damaging Het
Or8b3b A T 9: 38,584,435 (GRCm39) F102I probably damaging Het
Otx2 T A 14: 48,896,254 (GRCm39) K260M probably damaging Het
P2ry12 C T 3: 59,125,448 (GRCm39) D76N probably damaging Het
Parp3 A T 9: 106,351,922 (GRCm39) I150K probably damaging Het
Prex2 T G 1: 11,220,078 (GRCm39) I683S possibly damaging Het
Prss34 A T 17: 25,518,078 (GRCm39) K86I probably benign Het
Ptpn20 T A 14: 33,336,485 (GRCm39) V108D possibly damaging Het
Rlf A G 4: 121,007,729 (GRCm39) L417P probably benign Het
Rsad2 T C 12: 26,506,418 (GRCm39) M1V probably null Het
S1pr5 A G 9: 21,156,378 (GRCm39) V16A probably benign Het
Scn7a AT ATT 2: 66,531,239 (GRCm39) probably null Het
Serpinb3b A T 1: 107,082,425 (GRCm39) S280T probably benign Het
Sh3d21 A G 4: 126,056,625 (GRCm39) S66P probably benign Het
Sh3yl1 T C 12: 31,009,841 (GRCm39) S253P probably benign Het
Smarca2 A G 19: 26,668,749 (GRCm39) E916G probably damaging Het
Sptbn1 A G 11: 30,169,686 (GRCm39) I14T possibly damaging Het
Supt16 A T 14: 52,412,816 (GRCm39) M559K probably benign Het
Tas1r2 A G 4: 139,396,886 (GRCm39) T742A probably damaging Het
Tbc1d5 T C 17: 51,107,156 (GRCm39) K467E probably damaging Het
Tet3 A G 6: 83,380,401 (GRCm39) V589A probably damaging Het
Tmem131 A G 1: 36,847,902 (GRCm39) probably benign Het
Tmtc3 A G 10: 100,283,437 (GRCm39) F706S probably benign Het
Tsku T C 7: 98,001,746 (GRCm39) N195S probably damaging Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Vmn2r85 T A 10: 130,254,758 (GRCm39) H642L probably damaging Het
Zfc3h1 A G 10: 115,246,428 (GRCm39) probably benign Het
Other mutations in Marf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Marf1 APN 16 13,933,606 (GRCm39) missense possibly damaging 0.49
IGL00933:Marf1 APN 16 13,935,221 (GRCm39) missense probably damaging 1.00
IGL01101:Marf1 APN 16 13,964,600 (GRCm39) missense possibly damaging 0.85
IGL02140:Marf1 APN 16 13,959,776 (GRCm39) missense probably damaging 0.99
IGL03196:Marf1 APN 16 13,958,123 (GRCm39) missense possibly damaging 0.64
PIT4283001:Marf1 UTSW 16 13,946,432 (GRCm39) missense probably benign 0.22
R0016:Marf1 UTSW 16 13,970,129 (GRCm39) missense probably damaging 0.99
R0016:Marf1 UTSW 16 13,970,129 (GRCm39) missense probably damaging 0.99
R0046:Marf1 UTSW 16 13,929,591 (GRCm39) missense possibly damaging 0.83
R0046:Marf1 UTSW 16 13,929,591 (GRCm39) missense possibly damaging 0.83
R0056:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0057:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0058:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0058:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0113:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0115:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0179:Marf1 UTSW 16 13,969,040 (GRCm39) missense probably damaging 1.00
R0238:Marf1 UTSW 16 13,969,147 (GRCm39) missense probably benign 0.00
R0238:Marf1 UTSW 16 13,969,147 (GRCm39) missense probably benign 0.00
R0294:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0295:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0316:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0318:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0375:Marf1 UTSW 16 13,969,184 (GRCm39) splice site probably benign
R0383:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0391:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0504:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0589:Marf1 UTSW 16 13,959,919 (GRCm39) splice site probably benign
R0603:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R0610:Marf1 UTSW 16 13,960,398 (GRCm39) missense probably damaging 1.00
R1240:Marf1 UTSW 16 13,964,626 (GRCm39) missense possibly damaging 0.48
R1445:Marf1 UTSW 16 13,933,688 (GRCm39) missense probably benign
R1716:Marf1 UTSW 16 13,960,450 (GRCm39) missense possibly damaging 0.95
R1921:Marf1 UTSW 16 13,946,465 (GRCm39) missense possibly damaging 0.63
R2098:Marf1 UTSW 16 13,932,064 (GRCm39) missense probably benign 0.00
R2155:Marf1 UTSW 16 13,950,293 (GRCm39) missense probably damaging 0.99
R2177:Marf1 UTSW 16 13,970,471 (GRCm39) missense probably benign 0.01
R2195:Marf1 UTSW 16 13,929,563 (GRCm39) missense probably benign
R2410:Marf1 UTSW 16 13,933,691 (GRCm39) missense probably benign 0.02
R2999:Marf1 UTSW 16 13,960,505 (GRCm39) missense possibly damaging 0.60
R3000:Marf1 UTSW 16 13,960,505 (GRCm39) missense possibly damaging 0.60
R3147:Marf1 UTSW 16 13,943,843 (GRCm39) missense possibly damaging 0.64
R3148:Marf1 UTSW 16 13,943,843 (GRCm39) missense possibly damaging 0.64
R3821:Marf1 UTSW 16 13,960,418 (GRCm39) missense probably damaging 1.00
R4383:Marf1 UTSW 16 13,960,505 (GRCm39) missense possibly damaging 0.60
R4384:Marf1 UTSW 16 13,960,505 (GRCm39) missense possibly damaging 0.60
R4520:Marf1 UTSW 16 13,950,530 (GRCm39) missense probably damaging 0.98
R4554:Marf1 UTSW 16 13,971,841 (GRCm39) start gained probably benign
R4557:Marf1 UTSW 16 13,971,841 (GRCm39) start gained probably benign
R4768:Marf1 UTSW 16 13,949,461 (GRCm39) missense possibly damaging 0.93
R4784:Marf1 UTSW 16 13,970,321 (GRCm39) missense probably benign
R4857:Marf1 UTSW 16 13,946,475 (GRCm39) nonsense probably null
R4863:Marf1 UTSW 16 13,950,529 (GRCm39) missense possibly damaging 0.60
R4994:Marf1 UTSW 16 13,932,095 (GRCm39) missense probably benign
R5191:Marf1 UTSW 16 13,963,942 (GRCm39) missense probably damaging 1.00
R5503:Marf1 UTSW 16 13,970,095 (GRCm39) missense probably damaging 0.99
R5813:Marf1 UTSW 16 13,970,449 (GRCm39) missense probably benign 0.35
R5905:Marf1 UTSW 16 13,945,113 (GRCm39) missense probably damaging 0.99
R5960:Marf1 UTSW 16 13,970,281 (GRCm39) missense probably damaging 0.98
R6104:Marf1 UTSW 16 13,935,319 (GRCm39) missense probably damaging 0.99
R6387:Marf1 UTSW 16 13,959,504 (GRCm39) makesense probably null
R6533:Marf1 UTSW 16 13,933,663 (GRCm39) missense probably benign 0.16
R6608:Marf1 UTSW 16 13,950,578 (GRCm39) missense probably damaging 1.00
R6642:Marf1 UTSW 16 13,950,611 (GRCm39) missense probably benign 0.02
R6954:Marf1 UTSW 16 13,956,384 (GRCm39) missense probably damaging 1.00
R6994:Marf1 UTSW 16 13,946,721 (GRCm39) missense probably damaging 1.00
R7010:Marf1 UTSW 16 13,954,865 (GRCm39) missense probably damaging 0.99
R7090:Marf1 UTSW 16 13,929,566 (GRCm39) missense possibly damaging 0.52
R7174:Marf1 UTSW 16 13,954,817 (GRCm39) missense probably damaging 1.00
R7221:Marf1 UTSW 16 13,960,349 (GRCm39) missense probably damaging 1.00
R7247:Marf1 UTSW 16 13,944,957 (GRCm39) missense probably damaging 1.00
R7557:Marf1 UTSW 16 13,950,560 (GRCm39) missense probably damaging 1.00
R7798:Marf1 UTSW 16 13,956,315 (GRCm39) missense probably benign 0.00
R7807:Marf1 UTSW 16 13,971,753 (GRCm39) nonsense probably null
R7855:Marf1 UTSW 16 13,932,065 (GRCm39) missense probably benign 0.27
R7867:Marf1 UTSW 16 13,946,470 (GRCm39) missense probably damaging 0.97
R7893:Marf1 UTSW 16 13,964,599 (GRCm39) missense probably damaging 1.00
R8291:Marf1 UTSW 16 13,950,432 (GRCm39) critical splice donor site probably null
R8746:Marf1 UTSW 16 13,935,168 (GRCm39) missense probably benign 0.18
R8842:Marf1 UTSW 16 13,935,169 (GRCm39) missense probably damaging 1.00
R9253:Marf1 UTSW 16 13,935,172 (GRCm39) missense probably damaging 1.00
R9350:Marf1 UTSW 16 13,963,789 (GRCm39) missense probably damaging 1.00
R9440:Marf1 UTSW 16 13,938,196 (GRCm39) missense probably benign 0.01
R9460:Marf1 UTSW 16 13,947,526 (GRCm39) missense probably damaging 1.00
R9658:Marf1 UTSW 16 13,958,087 (GRCm39) missense probably damaging 1.00
R9698:Marf1 UTSW 16 13,967,077 (GRCm39) missense probably benign 0.00
U24488:Marf1 UTSW 16 13,950,230 (GRCm39) nonsense probably null
X0025:Marf1 UTSW 16 13,932,142 (GRCm39) missense probably damaging 1.00
Z1176:Marf1 UTSW 16 13,933,641 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATACCTCAGTACAGGGGAACGC -3'
(R):5'- TGAATAGAGCCTCACCACTTG -3'

Sequencing Primer
(F):5'- CTTTTGGGGTAGCATTGGAAATGAAG -3'
(R):5'- GAATAGAGCCTCACCACTTGCTTTC -3'
Posted On 2015-02-18