Mutagenetix > Incidental Mutation

Incidental Mutation 'R3431:Uggt1'

268100

Institutional Source

Beutler Lab

Gene Symbol

Uggt1

Ensembl Gene

ENSMUSG00000037470

Gene Name

UDP-glucose glycoprotein glucosyltransferase 1

Synonyms

Ugcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik

MMRRC Submission

040649-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.450) question?

Stock #

R3431 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36140027-36244720 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 36210059 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 267 (E267*)

Ref Sequence

ENSEMBL: ENSMUSP00000037930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000174266]

AlphaFold

Q6P5E4

Predicted Effect

probably null
Transcript: ENSMUST00000046875
AA Change: E267*

SMART Domains

Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: E267*

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
Pfam:UDP-g_GGTase	44	1222	N/A	PFAM
SCOP:d1ga8a_	1256	1521	3e-45	SMART
Blast:BROMO	1414	1453	3e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172592

Predicted Effect

probably benign
Transcript: ENSMUST00000174142

SMART Domains

Protein: ENSMUSP00000133929
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
Pfam:UDP-g_GGTase	1	52	7.8e-11	PFAM

Predicted Effect

silent
Transcript: ENSMUST00000174266

SMART Domains

Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174716

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	A	G	5: 35,589,216	H140R	possibly damaging	Het
Adamts3	A	G	5: 89,707,453		probably benign	Het
Apob	T	G	12: 8,010,778	F3054V	probably damaging	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Calcb	A	T	7: 114,719,829	R30W	probably damaging	Het
Cbl	T	C	9: 44,151,446	*914W	probably null	Het
Chd4	A	G	6: 125,120,560		probably benign	Het
Clec4a2	A	T	6: 123,139,411		probably null	Het
Crb2	T	A	2: 37,792,217	V870E	probably benign	Het
Cyp2c39	A	G	19: 39,536,862	E203G	probably damaging	Het
Dhrs7	A	T	12: 72,664,727	L12Q	probably damaging	Het
Dnah5	A	G	15: 28,295,267	Y1382C	probably benign	Het
Efs	C	T	14: 54,920,224	R117Q	probably damaging	Het
Evl	T	C	12: 108,648,308		probably benign	Het
Fbxo16	T	C	14: 65,293,784	F46L	probably damaging	Het
Fsip2	A	G	2: 82,992,010	E6029G	possibly damaging	Het
Gm20775	A	T	Y: 10,641,956		noncoding transcript	Het
Gm4924	T	A	10: 82,379,030	Y887*	probably null	Het
H60c	G	T	10: 3,260,382	R56S	possibly damaging	Het
Hbq1a	T	G	11: 32,300,715	S133A	probably benign	Het
Hhipl1	A	G	12: 108,311,689	E92G	probably damaging	Het
Knl1	A	T	2: 119,062,362	E46D	probably damaging	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Mfsd13a	C	T	19: 46,371,992	R328C	probably damaging	Het
Mmp21	T	C	7: 133,678,750	T164A	probably benign	Het
Mthfd2	T	C	6: 83,311,348	R142G	probably benign	Het
Mup4	T	G	4: 59,959,192		probably null	Het
Npas3	A	T	12: 54,069,049	Q900L	probably damaging	Het
Nr1h3	T	C	2: 91,191,860	D141G	probably damaging	Het
Rap2a	G	T	14: 120,503,758	A158S	possibly damaging	Het
Rttn	A	G	18: 89,095,571	T1705A	probably benign	Het
Ryr3	A	T	2: 112,656,531	V3834E	probably damaging	Het
Taf5	A	C	19: 47,075,833	K405T	probably damaging	Het
Tbc1d19	T	C	5: 53,848,206		probably benign	Het
Tmem232	A	T	17: 65,265,302		probably null	Het
Tssk4	A	G	14: 55,651,695	N226S	probably damaging	Het
Tulp4	C	A	17: 6,206,964	S311R	probably benign	Het
Usp34	T	C	11: 23,370,466	I917T	possibly damaging	Het

Other mutations in Uggt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Uggt1	APN	1	36179552	splice site	probably benign
IGL00817:Uggt1	APN	1	36185932	missense	probably benign	0.03
IGL01395:Uggt1	APN	1	36155077	missense	probably damaging	1.00
IGL01609:Uggt1	APN	1	36182474	missense	probably damaging	1.00
IGL01619:Uggt1	APN	1	36161694	missense	probably damaging	0.99
IGL02077:Uggt1	APN	1	36176794	missense	probably damaging	0.99
IGL02313:Uggt1	APN	1	36184484	missense	probably damaging	0.99
IGL02341:Uggt1	APN	1	36164519	makesense	probably null
IGL02346:Uggt1	APN	1	36179670	missense	probably benign	0.00
IGL02447:Uggt1	APN	1	36150142	missense	probably damaging	1.00
IGL02883:Uggt1	APN	1	36177615	missense	probably benign	0.03
IGL02930:Uggt1	APN	1	36157456	missense	probably benign	0.01
IGL03153:Uggt1	APN	1	36202818	missense	possibly damaging	0.94
IGL03162:Uggt1	APN	1	36207956	missense	probably damaging	1.00
IGL03170:Uggt1	APN	1	36163261	missense	probably damaging	1.00
IGL03266:Uggt1	APN	1	36150048	missense	probably damaging	1.00
K3955:Uggt1	UTSW	1	36162353	missense	probably benign	0.37
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0167:Uggt1	UTSW	1	36170197	critical splice donor site	probably null
R0373:Uggt1	UTSW	1	36179670	missense	probably benign	0.00
R0502:Uggt1	UTSW	1	36159946	missense	probably damaging	1.00
R0546:Uggt1	UTSW	1	36195971	missense	probably benign	0.00
R0610:Uggt1	UTSW	1	36165506	splice site	probably benign
R0671:Uggt1	UTSW	1	36155128	missense	probably damaging	1.00
R0760:Uggt1	UTSW	1	36161724	missense	possibly damaging	0.68
R0825:Uggt1	UTSW	1	36158143	missense	probably benign	0.01
R0827:Uggt1	UTSW	1	36156313	critical splice acceptor site	probably null
R0884:Uggt1	UTSW	1	36175078	missense	probably benign	0.00
R1112:Uggt1	UTSW	1	36173546	missense	possibly damaging	0.54
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1592:Uggt1	UTSW	1	36202858	missense	probably benign	0.04
R1730:Uggt1	UTSW	1	36221261	missense	probably benign	0.05
R1923:Uggt1	UTSW	1	36179613	missense	probably damaging	0.99
R1970:Uggt1	UTSW	1	36151781	missense	probably damaging	1.00
R2086:Uggt1	UTSW	1	36192414	missense	probably null	1.00
R2829:Uggt1	UTSW	1	36162294	missense	probably benign	0.38
R3432:Uggt1	UTSW	1	36210059	nonsense	probably null
R3725:Uggt1	UTSW	1	36182507	nonsense	probably null
R3880:Uggt1	UTSW	1	36176804	intron	probably benign
R4052:Uggt1	UTSW	1	36164489	missense	probably damaging	0.98
R4133:Uggt1	UTSW	1	36158159	missense	probably damaging	1.00
R4489:Uggt1	UTSW	1	36146668	nonsense	probably null
R4570:Uggt1	UTSW	1	36150073	missense	probably damaging	1.00
R4866:Uggt1	UTSW	1	36202855	nonsense	probably null
R4895:Uggt1	UTSW	1	36156264	missense	probably damaging	1.00
R4900:Uggt1	UTSW	1	36202855	nonsense	probably null
R5372:Uggt1	UTSW	1	36244060	splice site	probably benign
R5385:Uggt1	UTSW	1	36184412	missense	probably damaging	1.00
R5652:Uggt1	UTSW	1	36216153	nonsense	probably null
R5694:Uggt1	UTSW	1	36179656	missense	probably damaging	1.00
R5732:Uggt1	UTSW	1	36161771	splice site	probably null
R5893:Uggt1	UTSW	1	36227628	splice site	probably null
R6191:Uggt1	UTSW	1	36162208	missense	probably damaging	0.98
R6247:Uggt1	UTSW	1	36163228	missense	probably damaging	1.00
R6259:Uggt1	UTSW	1	36234916	missense	probably benign	0.00
R6399:Uggt1	UTSW	1	36163366	missense	possibly damaging	0.90
R6439:Uggt1	UTSW	1	36174951	missense	possibly damaging	0.95
R6468:Uggt1	UTSW	1	36173450	missense	probably benign	0.00
R6788:Uggt1	UTSW	1	36230688	missense	probably benign	0.00
R7165:Uggt1	UTSW	1	36155107	missense	probably benign	0.41
R7255:Uggt1	UTSW	1	36146106	missense	probably damaging	1.00
R7273:Uggt1	UTSW	1	36162221	missense	probably damaging	0.99
R7469:Uggt1	UTSW	1	36151733	missense	probably damaging	1.00
R7490:Uggt1	UTSW	1	36164508	missense	probably benign	0.01
R7570:Uggt1	UTSW	1	36185838	missense	probably benign	0.09
R7612:Uggt1	UTSW	1	36163235	missense	probably damaging	0.99
R7759:Uggt1	UTSW	1	36146725	missense	possibly damaging	0.81
R7792:Uggt1	UTSW	1	36207984	missense	probably damaging	1.00
R7816:Uggt1	UTSW	1	36163315	missense	possibly damaging	0.95
R7858:Uggt1	UTSW	1	36156258	missense	probably damaging	1.00
R7887:Uggt1	UTSW	1	36208034	missense	probably damaging	0.99
R8040:Uggt1	UTSW	1	36211473	missense	possibly damaging	0.70
R8093:Uggt1	UTSW	1	36227485	missense	probably damaging	1.00
R8245:Uggt1	UTSW	1	36165564	missense	probably damaging	1.00
R8338:Uggt1	UTSW	1	36227521	missense	probably damaging	1.00
R8353:Uggt1	UTSW	1	36170296	critical splice acceptor site	probably null
R8442:Uggt1	UTSW	1	36173487	missense	probably damaging	0.99
R8519:Uggt1	UTSW	1	36176643	splice site	probably null
R8529:Uggt1	UTSW	1	36184432	missense	possibly damaging	0.85
R8730:Uggt1	UTSW	1	36197543	critical splice donor site	probably null
R8917:Uggt1	UTSW	1	36146654	missense
R8947:Uggt1	UTSW	1	36158148	missense	probably benign	0.12
R9240:Uggt1	UTSW	1	36182615	missense	possibly damaging	0.50
R9248:Uggt1	UTSW	1	36210022	missense	possibly damaging	0.80
R9401:Uggt1	UTSW	1	36216131	critical splice donor site	probably null
R9414:Uggt1	UTSW	1	36184426	missense	probably benign	0.01
R9416:Uggt1	UTSW	1	36164522	missense
R9441:Uggt1	UTSW	1	36221225	missense	probably benign	0.02
R9489:Uggt1	UTSW	1	36234805	critical splice donor site	probably null
R9563:Uggt1	UTSW	1	36165546	missense	possibly damaging	0.60
R9605:Uggt1	UTSW	1	36234805	critical splice donor site	probably null
X0022:Uggt1	UTSW	1	36165555	missense	possibly damaging	0.67
Z1088:Uggt1	UTSW	1	36174191	missense	probably damaging	1.00
Z1176:Uggt1	UTSW	1	36161695	missense	probably damaging	1.00
Z1177:Uggt1	UTSW	1	36155073	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CGGTGGACTCTGTATAGAACG -3'
(R):5'- TGCTGCTCTCTCAGTGATGG -3'

Sequencing Primer
(F):5'- CTCTGTATAGAACGTCCTGTAGAGC -3'
(R):5'- CTGCTCTCTCAGTGATGGTTAGG -3'

Posted On

2015-02-18