Incidental Mutation 'R3431:Adamts3'
ID 268110
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms 1100001H14Rik, 6330442E02Rik
MMRRC Submission 040649-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3431 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 89824946-90031193 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 89855312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
AlphaFold E9Q287
Predicted Effect probably benign
Transcript: ENSMUST00000061427
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163159
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,746,560 (GRCm39) H140R possibly damaging Het
Apob T G 12: 8,060,778 (GRCm39) F3054V probably damaging Het
Bahd1 G A 2: 118,753,004 (GRCm39) R757H probably damaging Het
Calcb A T 7: 114,319,064 (GRCm39) R30W probably damaging Het
Cbl T C 9: 44,062,743 (GRCm39) *914W probably null Het
Chd4 A G 6: 125,097,523 (GRCm39) probably benign Het
Clec4a2 A T 6: 123,116,370 (GRCm39) probably null Het
Crb2 T A 2: 37,682,229 (GRCm39) V870E probably benign Het
Cyp2c39 A G 19: 39,525,306 (GRCm39) E203G probably damaging Het
Dhrs7 A T 12: 72,711,501 (GRCm39) L12Q probably damaging Het
Dnah5 A G 15: 28,295,413 (GRCm39) Y1382C probably benign Het
Efs C T 14: 55,157,681 (GRCm39) R117Q probably damaging Het
Evl T C 12: 108,614,567 (GRCm39) probably benign Het
Fbxo16 T C 14: 65,531,233 (GRCm39) F46L probably damaging Het
Fsip2 A G 2: 82,822,354 (GRCm39) E6029G possibly damaging Het
Gm20775 A T Y: 10,641,956 (GRCm39) noncoding transcript Het
Gm4924 T A 10: 82,214,864 (GRCm39) Y887* probably null Het
H60c G T 10: 3,210,382 (GRCm39) R56S possibly damaging Het
Hbq1a T G 11: 32,250,715 (GRCm39) S133A probably benign Het
Hhipl1 A G 12: 108,277,948 (GRCm39) E92G probably damaging Het
Knl1 A T 2: 118,892,843 (GRCm39) E46D probably damaging Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Mfsd13a C T 19: 46,360,431 (GRCm39) R328C probably damaging Het
Mmp21 T C 7: 133,280,479 (GRCm39) T164A probably benign Het
Mthfd2 T C 6: 83,288,330 (GRCm39) R142G probably benign Het
Mup4 T G 4: 59,959,192 (GRCm39) probably null Het
Npas3 A T 12: 54,115,832 (GRCm39) Q900L probably damaging Het
Nr1h3 T C 2: 91,022,205 (GRCm39) D141G probably damaging Het
Rap2a G T 14: 120,741,170 (GRCm39) A158S possibly damaging Het
Rttn A G 18: 89,113,695 (GRCm39) T1705A probably benign Het
Ryr3 A T 2: 112,486,876 (GRCm39) V3834E probably damaging Het
Taf5 A C 19: 47,064,272 (GRCm39) K405T probably damaging Het
Tbc1d19 T C 5: 54,005,548 (GRCm39) probably benign Het
Tmem232 A T 17: 65,572,297 (GRCm39) probably null Het
Tssk4 A G 14: 55,889,152 (GRCm39) N226S probably damaging Het
Tulp4 C A 17: 6,257,239 (GRCm39) S311R probably benign Het
Uggt1 C A 1: 36,249,140 (GRCm39) E267* probably null Het
Usp34 T C 11: 23,320,466 (GRCm39) I917T possibly damaging Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 90,009,184 (GRCm39) missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89,849,525 (GRCm39) missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89,832,235 (GRCm39) missense probably benign 0.06
IGL01420:Adamts3 APN 5 89,850,916 (GRCm39) missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89,850,802 (GRCm39) missense probably benign 0.14
IGL01676:Adamts3 APN 5 90,029,402 (GRCm39) missense possibly damaging 0.54
IGL01676:Adamts3 APN 5 89,825,613 (GRCm39) missense probably benign 0.00
IGL01678:Adamts3 APN 5 89,855,715 (GRCm39) missense probably damaging 1.00
IGL01936:Adamts3 APN 5 90,009,282 (GRCm39) missense probably benign 0.00
IGL01956:Adamts3 APN 5 89,825,770 (GRCm39) missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89,839,332 (GRCm39) splice site probably null
IGL02415:Adamts3 APN 5 89,854,506 (GRCm39) splice site probably null
IGL03261:Adamts3 APN 5 90,030,756 (GRCm39) utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89,855,263 (GRCm39) missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89,832,326 (GRCm39) missense probably benign
R0079:Adamts3 UTSW 5 89,840,912 (GRCm39) missense probably benign 0.00
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0477:Adamts3 UTSW 5 89,832,366 (GRCm39) missense probably benign
R0605:Adamts3 UTSW 5 90,009,334 (GRCm39) missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89,843,952 (GRCm39) splice site probably benign
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1621:Adamts3 UTSW 5 89,869,560 (GRCm39) missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89,923,280 (GRCm39) missense probably benign 0.00
R2163:Adamts3 UTSW 5 89,856,577 (GRCm39) missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89,849,630 (GRCm39) missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2921:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89,849,592 (GRCm39) missense probably benign 0.04
R3432:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3813:Adamts3 UTSW 5 89,825,785 (GRCm39) missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89,853,123 (GRCm39) missense probably damaging 0.99
R3905:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3906:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3907:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3908:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89,848,346 (GRCm39) missense probably benign 0.03
R4684:Adamts3 UTSW 5 89,850,866 (GRCm39) missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89,825,675 (GRCm39) missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89,832,182 (GRCm39) missense probably benign 0.01
R5097:Adamts3 UTSW 5 89,840,909 (GRCm39) missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89,856,502 (GRCm39) missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89,923,236 (GRCm39) missense probably benign
R5265:Adamts3 UTSW 5 90,009,411 (GRCm39) missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89,855,159 (GRCm39) splice site probably null
R5413:Adamts3 UTSW 5 89,856,626 (GRCm39) missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89,839,332 (GRCm39) splice site probably null
R5738:Adamts3 UTSW 5 89,856,527 (GRCm39) missense probably damaging 1.00
R5979:Adamts3 UTSW 5 90,009,528 (GRCm39) missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89,839,194 (GRCm39) missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89,869,673 (GRCm39) missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 90,009,468 (GRCm39) missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 90,009,354 (GRCm39) missense probably damaging 1.00
R7172:Adamts3 UTSW 5 90,030,860 (GRCm39) start gained probably benign
R7263:Adamts3 UTSW 5 89,825,601 (GRCm39) missense probably benign 0.03
R7401:Adamts3 UTSW 5 89,855,309 (GRCm39) critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 90,009,256 (GRCm39) missense probably benign 0.00
R7829:Adamts3 UTSW 5 90,009,349 (GRCm39) missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89,848,299 (GRCm39) missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 90,009,288 (GRCm39) missense probably benign 0.10
R8021:Adamts3 UTSW 5 89,831,043 (GRCm39) missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89,923,282 (GRCm39) missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89,850,815 (GRCm39) missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89,842,627 (GRCm39) missense probably benign 0.19
R8827:Adamts3 UTSW 5 89,839,324 (GRCm39) missense probably benign 0.03
R8864:Adamts3 UTSW 5 89,854,981 (GRCm39) intron probably benign
R8906:Adamts3 UTSW 5 89,825,575 (GRCm39) missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89,854,570 (GRCm39) missense probably benign 0.17
R9005:Adamts3 UTSW 5 89,825,693 (GRCm39) missense probably benign 0.08
R9378:Adamts3 UTSW 5 89,848,269 (GRCm39) nonsense probably null
R9505:Adamts3 UTSW 5 89,855,751 (GRCm39) missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89,834,750 (GRCm39) missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89,850,901 (GRCm39) missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89,832,308 (GRCm39) missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,855,723 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATATGTGTAGCCTATGCAGCAG -3'
(R):5'- GAGTAACTCTGTTTGGCTGAGC -3'

Sequencing Primer
(F):5'- TGCAGCAGGGCATGACATG -3'
(R):5'- TACCTGTGCTGTGCCACTGATG -3'
Posted On 2015-02-18