Incidental Mutation 'R3431:Cbl'
ID 268118
Institutional Source Beutler Lab
Gene Symbol Cbl
Ensembl Gene ENSMUSG00000034342
Gene Name Casitas B-lineage lymphoma
Synonyms Cbl-2, 4732447J05Rik, c-Cbl
MMRRC Submission 040649-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.503) question?
Stock # R3431 (G1)
Quality Score 109
Status Not validated
Chromosome 9
Chromosomal Location 44054273-44145346 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 44062743 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Tryptophan at position 914 (*914W)
Ref Sequence ENSEMBL: ENSMUSP00000146244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037644] [ENSMUST00000205968] [ENSMUST00000206147] [ENSMUST00000206720]
AlphaFold P22682
Predicted Effect probably null
Transcript: ENSMUST00000037644
AA Change: *870W
SMART Domains Protein: ENSMUSP00000041902
Gene: ENSMUSG00000034342
AA Change: *870W

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Pfam:Cbl_N 49 173 9.4e-59 PFAM
Pfam:Cbl_N2 177 260 4.7e-44 PFAM
Pfam:Cbl_N3 262 347 7.2e-48 PFAM
RING 379 417 1.04e-7 SMART
low complexity region 454 463 N/A INTRINSIC
low complexity region 530 549 N/A INTRINSIC
UBA 864 901 3.17e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205313
Predicted Effect probably null
Transcript: ENSMUST00000205968
AA Change: *897W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206125
Predicted Effect probably benign
Transcript: ENSMUST00000206147
Predicted Effect probably benign
Transcript: ENSMUST00000206258
Predicted Effect probably null
Transcript: ENSMUST00000206720
AA Change: *914W
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased thymic CD3 and CD4 expression and tyrosine-phosphorylation, lymphoid hyperplasia, and altered splenic hemopoiesis. Females show increased ductal density and branching in mammary fat pads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,746,560 (GRCm39) H140R possibly damaging Het
Adamts3 A G 5: 89,855,312 (GRCm39) probably benign Het
Apob T G 12: 8,060,778 (GRCm39) F3054V probably damaging Het
Bahd1 G A 2: 118,753,004 (GRCm39) R757H probably damaging Het
Calcb A T 7: 114,319,064 (GRCm39) R30W probably damaging Het
Chd4 A G 6: 125,097,523 (GRCm39) probably benign Het
Clec4a2 A T 6: 123,116,370 (GRCm39) probably null Het
Crb2 T A 2: 37,682,229 (GRCm39) V870E probably benign Het
Cyp2c39 A G 19: 39,525,306 (GRCm39) E203G probably damaging Het
Dhrs7 A T 12: 72,711,501 (GRCm39) L12Q probably damaging Het
Dnah5 A G 15: 28,295,413 (GRCm39) Y1382C probably benign Het
Efs C T 14: 55,157,681 (GRCm39) R117Q probably damaging Het
Evl T C 12: 108,614,567 (GRCm39) probably benign Het
Fbxo16 T C 14: 65,531,233 (GRCm39) F46L probably damaging Het
Fsip2 A G 2: 82,822,354 (GRCm39) E6029G possibly damaging Het
Gm20775 A T Y: 10,641,956 (GRCm39) noncoding transcript Het
Gm4924 T A 10: 82,214,864 (GRCm39) Y887* probably null Het
H60c G T 10: 3,210,382 (GRCm39) R56S possibly damaging Het
Hbq1a T G 11: 32,250,715 (GRCm39) S133A probably benign Het
Hhipl1 A G 12: 108,277,948 (GRCm39) E92G probably damaging Het
Knl1 A T 2: 118,892,843 (GRCm39) E46D probably damaging Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Mfsd13a C T 19: 46,360,431 (GRCm39) R328C probably damaging Het
Mmp21 T C 7: 133,280,479 (GRCm39) T164A probably benign Het
Mthfd2 T C 6: 83,288,330 (GRCm39) R142G probably benign Het
Mup4 T G 4: 59,959,192 (GRCm39) probably null Het
Npas3 A T 12: 54,115,832 (GRCm39) Q900L probably damaging Het
Nr1h3 T C 2: 91,022,205 (GRCm39) D141G probably damaging Het
Rap2a G T 14: 120,741,170 (GRCm39) A158S possibly damaging Het
Rttn A G 18: 89,113,695 (GRCm39) T1705A probably benign Het
Ryr3 A T 2: 112,486,876 (GRCm39) V3834E probably damaging Het
Taf5 A C 19: 47,064,272 (GRCm39) K405T probably damaging Het
Tbc1d19 T C 5: 54,005,548 (GRCm39) probably benign Het
Tmem232 A T 17: 65,572,297 (GRCm39) probably null Het
Tssk4 A G 14: 55,889,152 (GRCm39) N226S probably damaging Het
Tulp4 C A 17: 6,257,239 (GRCm39) S311R probably benign Het
Uggt1 C A 1: 36,249,140 (GRCm39) E267* probably null Het
Usp34 T C 11: 23,320,466 (GRCm39) I917T possibly damaging Het
Other mutations in Cbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Cbl APN 9 44,112,495 (GRCm39) missense probably damaging 1.00
IGL01369:Cbl APN 9 44,112,358 (GRCm39) nonsense probably null
IGL01434:Cbl APN 9 44,075,503 (GRCm39) missense probably damaging 0.99
IGL01866:Cbl APN 9 44,065,122 (GRCm39) nonsense probably null
IGL02326:Cbl APN 9 44,062,770 (GRCm39) missense possibly damaging 0.94
IGL02956:Cbl APN 9 44,080,331 (GRCm39) missense probably damaging 1.00
Bungalow UTSW 9 44,112,416 (GRCm39) missense probably damaging 1.00
Casita UTSW 9 44,075,462 (GRCm39) missense probably damaging 1.00
tiny_house UTSW 9 44,075,449 (GRCm39) missense probably damaging 1.00
R0068:Cbl UTSW 9 44,065,491 (GRCm39) missense probably damaging 0.98
R0390:Cbl UTSW 9 44,112,302 (GRCm39) missense probably damaging 1.00
R0655:Cbl UTSW 9 44,070,049 (GRCm39) missense probably damaging 1.00
R0764:Cbl UTSW 9 44,075,449 (GRCm39) missense probably damaging 1.00
R1466:Cbl UTSW 9 44,065,541 (GRCm39) missense probably benign 0.10
R1466:Cbl UTSW 9 44,065,541 (GRCm39) missense probably benign 0.10
R1616:Cbl UTSW 9 44,064,197 (GRCm39) missense probably damaging 0.99
R1736:Cbl UTSW 9 44,064,192 (GRCm39) missense possibly damaging 0.80
R1808:Cbl UTSW 9 44,075,526 (GRCm39) missense probably damaging 1.00
R1865:Cbl UTSW 9 44,075,462 (GRCm39) missense probably damaging 1.00
R3156:Cbl UTSW 9 44,070,147 (GRCm39) missense possibly damaging 0.74
R4668:Cbl UTSW 9 44,065,145 (GRCm39) missense probably benign 0.00
R4700:Cbl UTSW 9 44,084,677 (GRCm39) missense probably damaging 1.00
R4866:Cbl UTSW 9 44,064,166 (GRCm39) missense probably benign 0.00
R4900:Cbl UTSW 9 44,064,166 (GRCm39) missense probably benign 0.00
R4995:Cbl UTSW 9 44,065,108 (GRCm39) missense possibly damaging 0.62
R5014:Cbl UTSW 9 44,065,696 (GRCm39) splice site probably null
R5324:Cbl UTSW 9 44,065,551 (GRCm39) missense probably damaging 0.97
R5353:Cbl UTSW 9 44,084,620 (GRCm39) missense probably damaging 1.00
R5382:Cbl UTSW 9 44,070,318 (GRCm39) missense probably benign
R5747:Cbl UTSW 9 44,112,416 (GRCm39) missense probably damaging 1.00
R5834:Cbl UTSW 9 44,145,076 (GRCm39) missense probably damaging 1.00
R6307:Cbl UTSW 9 44,069,809 (GRCm39) critical splice donor site probably null
R6755:Cbl UTSW 9 44,084,671 (GRCm39) missense probably damaging 0.98
R7393:Cbl UTSW 9 44,065,485 (GRCm39) critical splice donor site probably null
R7779:Cbl UTSW 9 44,070,393 (GRCm39) missense probably benign
R7789:Cbl UTSW 9 44,074,764 (GRCm39) missense probably damaging 1.00
R8094:Cbl UTSW 9 44,074,696 (GRCm39) missense probably benign 0.03
R8104:Cbl UTSW 9 44,069,836 (GRCm39) missense possibly damaging 0.93
R8146:Cbl UTSW 9 44,076,171 (GRCm39) missense probably damaging 1.00
R8340:Cbl UTSW 9 44,070,297 (GRCm39) missense possibly damaging 0.77
R8424:Cbl UTSW 9 44,064,151 (GRCm39) missense possibly damaging 0.51
R8920:Cbl UTSW 9 44,078,570 (GRCm39) missense probably damaging 0.99
R9185:Cbl UTSW 9 44,064,137 (GRCm39) missense probably damaging 1.00
X0057:Cbl UTSW 9 44,145,064 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGAAACACATCAGCTGCTCC -3'
(R):5'- AGTAGCTATCAACAAGGCGG -3'

Sequencing Primer
(F):5'- GAAACACATCAGCTGCTCCATTTTC -3'
(R):5'- GTGCCACTGCTAACCCTGTG -3'
Posted On 2015-02-18