Incidental Mutation 'R3431:Efs'
ID 268128
Institutional Source Beutler Lab
Gene Symbol Efs
Ensembl Gene ENSMUSG00000022203
Gene Name embryonal Fyn-associated substrate
Synonyms
MMRRC Submission 040649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R3431 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 55153992-55163583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 55157681 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 117 (R117Q)
Ref Sequence ENSEMBL: ENSMUSP00000154657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022813] [ENSMUST00000227037] [ENSMUST00000227587]
AlphaFold Q64355
Predicted Effect probably damaging
Transcript: ENSMUST00000022813
AA Change: R210Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022813
Gene: ENSMUSG00000022203
AA Change: R210Q

DomainStartEndE-ValueType
SH3 8 67 5.15e-19 SMART
low complexity region 201 215 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 305 325 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Pfam:DUF3513 370 555 9.2e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227037
AA Change: R117Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000227587
Meta Mutation Damage Score 0.2071 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The longest protein isoform encoded by this gene contains an SH3 domain, which is known to be important in intracellular signal transduction. The protein encoded by a similiar gene in mice was shown to bind to SH3 domains of protein-tyrosine kinases. The function of this gene is unknown. Three alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display an increased inflammatory response characterized by excessive T cell responses, enhanced cytokine secretion and antibody production, and intestinal, kidney, liver, and lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,746,560 (GRCm39) H140R possibly damaging Het
Adamts3 A G 5: 89,855,312 (GRCm39) probably benign Het
Apob T G 12: 8,060,778 (GRCm39) F3054V probably damaging Het
Bahd1 G A 2: 118,753,004 (GRCm39) R757H probably damaging Het
Calcb A T 7: 114,319,064 (GRCm39) R30W probably damaging Het
Cbl T C 9: 44,062,743 (GRCm39) *914W probably null Het
Chd4 A G 6: 125,097,523 (GRCm39) probably benign Het
Clec4a2 A T 6: 123,116,370 (GRCm39) probably null Het
Crb2 T A 2: 37,682,229 (GRCm39) V870E probably benign Het
Cyp2c39 A G 19: 39,525,306 (GRCm39) E203G probably damaging Het
Dhrs7 A T 12: 72,711,501 (GRCm39) L12Q probably damaging Het
Dnah5 A G 15: 28,295,413 (GRCm39) Y1382C probably benign Het
Evl T C 12: 108,614,567 (GRCm39) probably benign Het
Fbxo16 T C 14: 65,531,233 (GRCm39) F46L probably damaging Het
Fsip2 A G 2: 82,822,354 (GRCm39) E6029G possibly damaging Het
Gm20775 A T Y: 10,641,956 (GRCm39) noncoding transcript Het
Gm4924 T A 10: 82,214,864 (GRCm39) Y887* probably null Het
H60c G T 10: 3,210,382 (GRCm39) R56S possibly damaging Het
Hbq1a T G 11: 32,250,715 (GRCm39) S133A probably benign Het
Hhipl1 A G 12: 108,277,948 (GRCm39) E92G probably damaging Het
Knl1 A T 2: 118,892,843 (GRCm39) E46D probably damaging Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Mfsd13a C T 19: 46,360,431 (GRCm39) R328C probably damaging Het
Mmp21 T C 7: 133,280,479 (GRCm39) T164A probably benign Het
Mthfd2 T C 6: 83,288,330 (GRCm39) R142G probably benign Het
Mup4 T G 4: 59,959,192 (GRCm39) probably null Het
Npas3 A T 12: 54,115,832 (GRCm39) Q900L probably damaging Het
Nr1h3 T C 2: 91,022,205 (GRCm39) D141G probably damaging Het
Rap2a G T 14: 120,741,170 (GRCm39) A158S possibly damaging Het
Rttn A G 18: 89,113,695 (GRCm39) T1705A probably benign Het
Ryr3 A T 2: 112,486,876 (GRCm39) V3834E probably damaging Het
Taf5 A C 19: 47,064,272 (GRCm39) K405T probably damaging Het
Tbc1d19 T C 5: 54,005,548 (GRCm39) probably benign Het
Tmem232 A T 17: 65,572,297 (GRCm39) probably null Het
Tssk4 A G 14: 55,889,152 (GRCm39) N226S probably damaging Het
Tulp4 C A 17: 6,257,239 (GRCm39) S311R probably benign Het
Uggt1 C A 1: 36,249,140 (GRCm39) E267* probably null Het
Usp34 T C 11: 23,320,466 (GRCm39) I917T possibly damaging Het
Other mutations in Efs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Efs APN 14 55,158,499 (GRCm39) missense probably damaging 1.00
IGL02720:Efs APN 14 55,157,172 (GRCm39) missense probably damaging 1.00
IGL02752:Efs APN 14 55,154,880 (GRCm39) missense probably damaging 0.96
R0129:Efs UTSW 14 55,154,680 (GRCm39) missense probably damaging 1.00
R1522:Efs UTSW 14 55,157,172 (GRCm39) missense probably damaging 1.00
R1927:Efs UTSW 14 55,154,620 (GRCm39) missense possibly damaging 0.89
R2327:Efs UTSW 14 55,154,961 (GRCm39) missense probably benign 0.01
R3432:Efs UTSW 14 55,157,681 (GRCm39) missense probably damaging 1.00
R3615:Efs UTSW 14 55,157,552 (GRCm39) missense probably damaging 1.00
R3616:Efs UTSW 14 55,157,552 (GRCm39) missense probably damaging 1.00
R3756:Efs UTSW 14 55,157,879 (GRCm39) splice site probably benign
R3945:Efs UTSW 14 55,158,108 (GRCm39) splice site probably benign
R4448:Efs UTSW 14 55,157,649 (GRCm39) missense probably damaging 1.00
R4717:Efs UTSW 14 55,157,801 (GRCm39) missense probably damaging 0.99
R4819:Efs UTSW 14 55,154,610 (GRCm39) missense probably damaging 0.98
R5656:Efs UTSW 14 55,154,584 (GRCm39) missense probably damaging 1.00
R5946:Efs UTSW 14 55,156,951 (GRCm39) splice site probably null
R6054:Efs UTSW 14 55,158,614 (GRCm39) missense probably damaging 1.00
R7457:Efs UTSW 14 55,157,451 (GRCm39) missense probably benign
R7822:Efs UTSW 14 55,154,907 (GRCm39) missense probably benign 0.09
R7970:Efs UTSW 14 55,157,960 (GRCm39) critical splice donor site probably null
R8166:Efs UTSW 14 55,158,077 (GRCm39) missense probably damaging 1.00
R8347:Efs UTSW 14 55,157,241 (GRCm39) missense probably benign 0.28
R8896:Efs UTSW 14 55,157,756 (GRCm39) missense possibly damaging 0.80
R9438:Efs UTSW 14 55,156,868 (GRCm39) missense
R9703:Efs UTSW 14 55,156,871 (GRCm39) missense possibly damaging 0.88
X0028:Efs UTSW 14 55,158,078 (GRCm39) nonsense probably null
Z1176:Efs UTSW 14 55,157,793 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCAGTGGATGGTAGCCTG -3'
(R):5'- ATGATGTGCCTCCCAACATC -3'

Sequencing Primer
(F):5'- ACAGTGTCCAGGTCAGTGG -3'
(R):5'- AACATCCTCCGGGCTCC -3'
Posted On 2015-02-18