Incidental Mutation 'R3431:Efs'
ID268128
Institutional Source Beutler Lab
Gene Symbol Efs
Ensembl Gene ENSMUSG00000022203
Gene Nameembryonal Fyn-associated substrate
Synonyms
MMRRC Submission 040649-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R3431 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54916535-54926126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54920224 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 117 (R117Q)
Ref Sequence ENSEMBL: ENSMUSP00000154657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022813] [ENSMUST00000227037] [ENSMUST00000227587]
Predicted Effect probably damaging
Transcript: ENSMUST00000022813
AA Change: R210Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022813
Gene: ENSMUSG00000022203
AA Change: R210Q

DomainStartEndE-ValueType
SH3 8 67 5.15e-19 SMART
low complexity region 201 215 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 305 325 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Pfam:DUF3513 370 555 9.2e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227037
AA Change: R117Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000227587
Meta Mutation Damage Score 0.2071 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The longest protein isoform encoded by this gene contains an SH3 domain, which is known to be important in intracellular signal transduction. The protein encoded by a similiar gene in mice was shown to bind to SH3 domains of protein-tyrosine kinases. The function of this gene is unknown. Three alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display an increased inflammatory response characterized by excessive T cell responses, enhanced cytokine secretion and antibody production, and intestinal, kidney, liver, and lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,589,216 H140R possibly damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Apob T G 12: 8,010,778 F3054V probably damaging Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Calcb A T 7: 114,719,829 R30W probably damaging Het
Cbl T C 9: 44,151,446 *914W probably null Het
Chd4 A G 6: 125,120,560 probably benign Het
Clec4a2 A T 6: 123,139,411 probably null Het
Crb2 T A 2: 37,792,217 V870E probably benign Het
Cyp2c39 A G 19: 39,536,862 E203G probably damaging Het
Dhrs7 A T 12: 72,664,727 L12Q probably damaging Het
Dnah5 A G 15: 28,295,267 Y1382C probably benign Het
Evl T C 12: 108,648,308 probably benign Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Fsip2 A G 2: 82,992,010 E6029G possibly damaging Het
Gm20775 A T Y: 10,641,956 noncoding transcript Het
Gm4924 T A 10: 82,379,030 Y887* probably null Het
H60c G T 10: 3,260,382 R56S possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Knl1 A T 2: 119,062,362 E46D probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmp21 T C 7: 133,678,750 T164A probably benign Het
Mthfd2 T C 6: 83,311,348 R142G probably benign Het
Mup4 T G 4: 59,959,192 probably null Het
Npas3 A T 12: 54,069,049 Q900L probably damaging Het
Nr1h3 T C 2: 91,191,860 D141G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rttn A G 18: 89,095,571 T1705A probably benign Het
Ryr3 A T 2: 112,656,531 V3834E probably damaging Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Tmem232 A T 17: 65,265,302 probably null Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Tulp4 C A 17: 6,206,964 S311R probably benign Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Usp34 T C 11: 23,370,466 I917T possibly damaging Het
Other mutations in Efs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Efs APN 14 54921042 missense probably damaging 1.00
IGL02720:Efs APN 14 54919715 missense probably damaging 1.00
IGL02752:Efs APN 14 54917423 missense probably damaging 0.96
R0129:Efs UTSW 14 54917223 missense probably damaging 1.00
R1522:Efs UTSW 14 54919715 missense probably damaging 1.00
R1927:Efs UTSW 14 54917163 missense possibly damaging 0.89
R2327:Efs UTSW 14 54917504 missense probably benign 0.01
R3432:Efs UTSW 14 54920224 missense probably damaging 1.00
R3615:Efs UTSW 14 54920095 missense probably damaging 1.00
R3616:Efs UTSW 14 54920095 missense probably damaging 1.00
R3756:Efs UTSW 14 54920422 splice site probably benign
R3945:Efs UTSW 14 54920651 splice site probably benign
R4448:Efs UTSW 14 54920192 missense probably damaging 1.00
R4717:Efs UTSW 14 54920344 missense probably damaging 0.99
R4819:Efs UTSW 14 54917153 missense probably damaging 0.98
R5656:Efs UTSW 14 54917127 missense probably damaging 1.00
R5946:Efs UTSW 14 54919494 splice site probably null
R6054:Efs UTSW 14 54921157 missense probably damaging 1.00
R7457:Efs UTSW 14 54919994 missense probably benign
R7822:Efs UTSW 14 54917450 missense probably benign 0.09
R7970:Efs UTSW 14 54920503 critical splice donor site probably null
R8166:Efs UTSW 14 54920620 missense probably damaging 1.00
R8347:Efs UTSW 14 54919784 missense probably benign 0.28
X0028:Efs UTSW 14 54920621 nonsense probably null
Z1176:Efs UTSW 14 54920336 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCAGTGGATGGTAGCCTG -3'
(R):5'- ATGATGTGCCTCCCAACATC -3'

Sequencing Primer
(F):5'- ACAGTGTCCAGGTCAGTGG -3'
(R):5'- AACATCCTCCGGGCTCC -3'
Posted On2015-02-18