Incidental Mutation 'R3431:Tmem232'
ID268135
Institutional Source Beutler Lab
Gene Symbol Tmem232
Ensembl Gene ENSMUSG00000045036
Gene Nametransmembrane protein 232
SynonymsLOC381107, E130009J12Rik
MMRRC Submission 040649-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3431 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location65256005-65540782 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 65265302 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062161] [ENSMUST00000086722]
Predicted Effect probably null
Transcript: ENSMUST00000062161
SMART Domains Protein: ENSMUSP00000055652
Gene: ENSMUSG00000045036

DomainStartEndE-ValueType
Pfam:TMEM232 40 488 5.3e-235 PFAM
coiled coil region 598 634 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000086722
SMART Domains Protein: ENSMUSP00000083927
Gene: ENSMUSG00000045036

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
coiled coil region 598 634 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,589,216 H140R possibly damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Apob T G 12: 8,010,778 F3054V probably damaging Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Calcb A T 7: 114,719,829 R30W probably damaging Het
Cbl T C 9: 44,151,446 *914W probably null Het
Chd4 A G 6: 125,120,560 probably benign Het
Clec4a2 A T 6: 123,139,411 probably null Het
Crb2 T A 2: 37,792,217 V870E probably benign Het
Cyp2c39 A G 19: 39,536,862 E203G probably damaging Het
Dhrs7 A T 12: 72,664,727 L12Q probably damaging Het
Dnah5 A G 15: 28,295,267 Y1382C probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Fsip2 A G 2: 82,992,010 E6029G possibly damaging Het
Gm20775 A T Y: 10,641,956 noncoding transcript Het
Gm4924 T A 10: 82,379,030 Y887* probably null Het
H60c G T 10: 3,260,382 R56S possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Knl1 A T 2: 119,062,362 E46D probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmp21 T C 7: 133,678,750 T164A probably benign Het
Mthfd2 T C 6: 83,311,348 R142G probably benign Het
Mup4 T G 4: 59,959,192 probably null Het
Npas3 A T 12: 54,069,049 Q900L probably damaging Het
Nr1h3 T C 2: 91,191,860 D141G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rttn A G 18: 89,095,571 T1705A probably benign Het
Ryr3 A T 2: 112,656,531 V3834E probably damaging Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Tulp4 C A 17: 6,206,964 S311R probably benign Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Usp34 T C 11: 23,370,466 I917T possibly damaging Het
Other mutations in Tmem232
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Tmem232 APN 17 65256574 missense possibly damaging 0.71
IGL00954:Tmem232 APN 17 65500153 missense probably damaging 1.00
IGL01530:Tmem232 APN 17 65256548 nonsense probably null
IGL02881:Tmem232 APN 17 65450370 missense probably damaging 1.00
IGL02969:Tmem232 APN 17 65256563 missense possibly damaging 0.69
IGL02972:Tmem232 APN 17 65476673 missense probably benign 0.00
IGL03028:Tmem232 APN 17 65256389 missense probably benign 0.14
IGL03293:Tmem232 APN 17 65450374 missense probably damaging 1.00
R0380:Tmem232 UTSW 17 65256448 missense probably benign 0.23
R0432:Tmem232 UTSW 17 65256503 missense probably damaging 0.99
R0524:Tmem232 UTSW 17 65485942 missense probably damaging 0.98
R0548:Tmem232 UTSW 17 65382620 missense probably benign 0.22
R1345:Tmem232 UTSW 17 65450406 missense possibly damaging 0.60
R1521:Tmem232 UTSW 17 65484501 missense probably damaging 0.99
R1954:Tmem232 UTSW 17 65484487 missense probably benign 0.01
R1955:Tmem232 UTSW 17 65484487 missense probably benign 0.01
R2012:Tmem232 UTSW 17 65500172 missense probably benign 0.21
R2294:Tmem232 UTSW 17 65450441 missense probably benign 0.00
R2369:Tmem232 UTSW 17 65402997 missense probably damaging 1.00
R2384:Tmem232 UTSW 17 65402857 missense probably damaging 1.00
R2894:Tmem232 UTSW 17 65450413 missense probably damaging 1.00
R3788:Tmem232 UTSW 17 65382633 missense possibly damaging 0.71
R3789:Tmem232 UTSW 17 65382525 missense probably benign 0.02
R3789:Tmem232 UTSW 17 65382633 missense possibly damaging 0.71
R4155:Tmem232 UTSW 17 65436333 missense probably damaging 0.97
R4691:Tmem232 UTSW 17 65265242 missense possibly damaging 0.88
R4838:Tmem232 UTSW 17 65430888 missense probably benign 0.04
R5340:Tmem232 UTSW 17 65402998 missense possibly damaging 0.92
R5619:Tmem232 UTSW 17 65486511 missense probably benign 0.06
R6176:Tmem232 UTSW 17 65485872 missense probably damaging 1.00
R6192:Tmem232 UTSW 17 65430805 missense probably damaging 1.00
R6223:Tmem232 UTSW 17 65500196 start codon destroyed probably null 0.99
R6256:Tmem232 UTSW 17 65478402 missense possibly damaging 0.89
R6782:Tmem232 UTSW 17 65500124 missense possibly damaging 0.88
R6856:Tmem232 UTSW 17 65450310 missense possibly damaging 0.57
R7262:Tmem232 UTSW 17 65500117 missense probably benign
R7459:Tmem232 UTSW 17 65256389 missense probably benign 0.14
R7699:Tmem232 UTSW 17 65265218 missense probably damaging 0.97
R7700:Tmem232 UTSW 17 65265218 missense probably damaging 0.97
R8284:Tmem232 UTSW 17 65402995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGCTGTACAATGATATATGCAC -3'
(R):5'- GTAGAGTTTGCATCTGCCCAC -3'

Sequencing Primer
(F):5'- TAGGCTATGTATTTGAAGGAGAGTAG -3'
(R):5'- GCACATCAGTAGTCTATCAGA -3'
Posted On2015-02-18