Incidental Mutation 'R1723:Ecel1'
ID268141
Institutional Source Beutler Lab
Gene Symbol Ecel1
Ensembl Gene ENSMUSG00000026247
Gene Nameendothelin converting enzyme-like 1
SynonymsXCE, DINE
MMRRC Submission 039755-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1723 (G1)
Quality Score44.8
Status Validated
Chromosome1
Chromosomal Location87147655-87156521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87154421 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 190 (D190G)
Ref Sequence ENSEMBL: ENSMUSP00000125096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027463] [ENSMUST00000160810] [ENSMUST00000161002]
Predicted Effect probably benign
Transcript: ENSMUST00000027463
AA Change: D190G

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027463
Gene: ENSMUSG00000026247
AA Change: D190G

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 6.4e-112 PFAM
Pfam:Peptidase_M13 571 774 5.2e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159662
Predicted Effect probably benign
Transcript: ENSMUST00000160810
AA Change: D190G

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125557
Gene: ENSMUSG00000026247
AA Change: D190G

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 1.2e-98 PFAM
Pfam:Peptidase_M13 571 774 2.3e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161002
AA Change: D190G

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125096
Gene: ENSMUSG00000026247
AA Change: D190G

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 6.4e-112 PFAM
Pfam:Peptidase_M13 571 774 5.2e-66 PFAM
Meta Mutation Damage Score 0.1219 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M13 family of endopeptidases. Members of this family are zinc-containing type II integral-membrane proteins that are important regulators of neuropeptide and peptide hormone activity. Mutations in this gene are associated with autosomal recessive distal arthrogryposis, type 5D. This gene has multiple pseudogenes on chromosome 2. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Targeted mutations of this gene result in respiratory distress causing neonatal lethality due to reduced diaphram innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 G T 6: 85,628,753 G2462C probably damaging Het
Anapc5 T C 5: 122,799,343 E464G probably damaging Het
Aoc3 T A 11: 101,336,435 V378E possibly damaging Het
Atp13a5 T A 16: 29,232,799 K1152I possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC027072 A T 17: 71,750,378 F768Y probably damaging Het
Calcoco1 C A 15: 102,719,553 G49C probably damaging Het
Cbwd1 A G 19: 24,948,094 V166A possibly damaging Het
Cd70 T C 17: 57,146,401 T88A possibly damaging Het
Cpeb1 C T 7: 81,436,226 R56Q probably benign Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnhd1 C A 7: 105,714,920 P4160T possibly damaging Het
Exoc6b A G 6: 85,069,344 L21P probably damaging Het
Fam110c A G 12: 31,074,395 R119G unknown Het
Fam198b T A 3: 79,936,663 N32K probably benign Het
Gm42791 C A 5: 148,959,501 probably benign Het
Hpcal4 A G 4: 123,190,739 I154V probably benign Het
Itgb1 A G 8: 128,726,038 D728G probably damaging Het
Kdm5d A T Y: 927,753 D701V probably damaging Het
Kif18a A G 2: 109,302,882 K448E probably damaging Het
Kif26a T C 12: 112,173,858 F507S possibly damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrrc43 T A 5: 123,492,213 probably benign Het
Map3k20 T C 2: 72,389,492 I256T probably damaging Het
Med29 T A 7: 28,392,705 probably benign Het
Mob3b A G 4: 34,954,026 C215R probably damaging Het
Mtf2 T C 5: 108,088,070 Y87H probably damaging Het
Myo18a G A 11: 77,853,314 R1834K probably damaging Het
Nlrc4 T A 17: 74,441,908 D779V probably damaging Het
Olfr638 T C 7: 104,003,311 F18S probably damaging Het
Otud3 T C 4: 138,898,018 T242A probably damaging Het
Pnliprp1 T A 19: 58,732,142 M150K possibly damaging Het
Polm T A 11: 5,834,776 Q227L probably benign Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppfia2 T A 10: 106,915,672 probably null Het
Rad51 T G 2: 119,123,814 M168R probably benign Het
Senp2 A G 16: 22,028,042 T266A probably benign Het
Sfswap A G 5: 129,539,694 T401A probably benign Het
Slc35a4 C A 18: 36,682,735 T206K possibly damaging Het
Slc40a1 A G 1: 45,924,761 S23P probably damaging Het
Spef2 T C 15: 9,614,209 K1217R probably damaging Het
St18 A C 1: 6,810,685 probably benign Het
Tdrd6 T C 17: 43,628,327 D610G possibly damaging Het
Tmem163 C A 1: 127,551,371 R137L probably damaging Het
Tmem94 T A 11: 115,794,748 D942E probably damaging Het
Ttn T A 2: 76,750,410 I23380F possibly damaging Het
Uckl1 T A 2: 181,570,600 probably null Het
Vav2 T C 2: 27,318,964 D99G possibly damaging Het
Vmn2r30 T A 7: 7,334,260 I126F probably benign Het
Zbtb41 A T 1: 139,423,563 Q138L probably benign Het
Zfp599 T C 9: 22,258,065 Y37C probably damaging Het
Zfp784 T A 7: 5,035,783 T259S possibly damaging Het
Zfp954 T C 7: 7,115,838 S236G probably benign Het
Other mutations in Ecel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Ecel1 APN 1 87153193 missense possibly damaging 0.84
IGL01431:Ecel1 APN 1 87151504 missense probably damaging 0.99
IGL01992:Ecel1 APN 1 87149855 splice site probably benign
IGL02040:Ecel1 APN 1 87154923 missense probably benign 0.32
IGL02230:Ecel1 APN 1 87152194 missense probably damaging 1.00
IGL02801:Ecel1 APN 1 87152003 missense probably damaging 1.00
Capulin UTSW 1 87153301 missense probably damaging 0.99
R0139:Ecel1 UTSW 1 87154526 missense possibly damaging 0.95
R2118:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2119:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2120:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2122:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R3815:Ecel1 UTSW 1 87152900 missense probably damaging 0.97
R3836:Ecel1 UTSW 1 87150656 missense probably damaging 1.00
R4211:Ecel1 UTSW 1 87152150 missense probably damaging 1.00
R4685:Ecel1 UTSW 1 87152946 splice site probably null
R4841:Ecel1 UTSW 1 87153301 missense probably damaging 0.99
R4842:Ecel1 UTSW 1 87153301 missense probably damaging 0.99
R4888:Ecel1 UTSW 1 87148727 splice site probably benign
R4976:Ecel1 UTSW 1 87151139 missense probably benign 0.17
R5032:Ecel1 UTSW 1 87154253 missense probably damaging 0.97
R5119:Ecel1 UTSW 1 87151139 missense probably benign 0.17
R5393:Ecel1 UTSW 1 87152876 missense possibly damaging 0.95
R5798:Ecel1 UTSW 1 87151483 missense probably damaging 1.00
R5862:Ecel1 UTSW 1 87149596 missense probably benign 0.19
R5874:Ecel1 UTSW 1 87148009 missense probably benign 0.24
R6341:Ecel1 UTSW 1 87150471 splice site probably null
R6351:Ecel1 UTSW 1 87149509 missense possibly damaging 0.56
R6534:Ecel1 UTSW 1 87154842 missense probably benign 0.13
R7405:Ecel1 UTSW 1 87153516 critical splice donor site probably null
R7422:Ecel1 UTSW 1 87149612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGCTGACTGTAAGCGAGAAG -3'
(R):5'- TTCCATGACAGCGCACTACGAC -3'

Sequencing Primer
(F):5'- TAAGCGAGAAGAGCGCGG -3'
(R):5'- TGGCGCTCAAATACCTGG -3'
Posted On2015-02-19