Incidental Mutation 'R3545:Hexa'
ID268171
Institutional Source Beutler Lab
Gene Symbol Hexa
Ensembl Gene ENSMUSG00000025232
Gene Namehexosaminidase A
SynonymsHex-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R3545 (G1)
Quality Score211
Status Not validated
Chromosome9
Chromosomal Location59539540-59565109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59557298 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 157 (N157S)
Ref Sequence ENSEMBL: ENSMUSP00000026262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026262]
Predicted Effect probably damaging
Transcript: ENSMUST00000026262
AA Change: N157S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026262
Gene: ENSMUSG00000025232
AA Change: N157S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Glycohydro_20b2 23 145 3e-25 PFAM
Pfam:Glyco_hydro_20 167 487 1.6e-88 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the glycosyl hydrolase 20 family of proteins. The encoded preproprotein is proteolytically processed to generate the alpha subunit of the lysosomal enzyme beta-hexosaminidase. This enzyme, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Mice lacking the encoded protein exhibit accumulation of gangliosides in the brain and membranous cytoplasmic bodies in neurons. Certain mutations in the human ortholog of this gene cause Tay-Sachs disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutants accumulate excess amounts of GM2 ganglioside that is stored in neurons as membranous cytoplasmic bodies typically seen in the neurons of Tay-Sachs disease patients. However, the mutant mice appear to be functionally normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A G 14: 31,715,260 L646S probably benign Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Efl1 A T 7: 82,762,810 E802D probably benign Het
F11r T C 1: 171,461,261 V149A probably damaging Het
Fam103a1 T A 7: 81,768,522 probably null Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Fmn2 A G 1: 174,502,626 D194G unknown Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Herc3 T C 6: 58,856,685 S186P probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lig1 T A 7: 13,292,163 N281K possibly damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nid2 T A 14: 19,763,711 Y195N probably damaging Het
Nlrp9a T C 7: 26,557,332 I125T probably benign Het
Nme7 T C 1: 164,385,782 F343S probably damaging Het
Otud4 A G 8: 79,665,055 E443G probably damaging Het
Palld G T 8: 61,550,078 A329E possibly damaging Het
Pask A T 1: 93,317,115 V1095D probably damaging Het
Pdzd2 C T 15: 12,375,471 R1526Q probably benign Het
Prkcq A G 2: 11,283,816 K527E probably benign Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept9 T C 11: 117,352,673 I350T probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Spata32 T C 11: 103,210,744 E21G possibly damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Thnsl1 T G 2: 21,212,627 D397E probably benign Het
Tubal3 T G 13: 3,933,560 *447G probably null Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Other mutations in Hexa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Hexa APN 9 59563880 splice site probably benign
IGL02078:Hexa APN 9 59557303 missense probably benign 0.36
R0098:Hexa UTSW 9 59558100 missense probably damaging 1.00
R0098:Hexa UTSW 9 59558100 missense probably damaging 1.00
R0281:Hexa UTSW 9 59554226 critical splice donor site probably null
R0364:Hexa UTSW 9 59563935 missense probably benign 0.00
R0481:Hexa UTSW 9 59555410 splice site probably benign
R1888:Hexa UTSW 9 59557303 missense probably benign 0.36
R1888:Hexa UTSW 9 59557303 missense probably benign 0.36
R2264:Hexa UTSW 9 59555377 missense probably damaging 0.99
R4609:Hexa UTSW 9 59557319 missense probably benign 0.32
R5777:Hexa UTSW 9 59560960 missense probably damaging 0.99
R6041:Hexa UTSW 9 59563236 missense probably damaging 0.99
R6403:Hexa UTSW 9 59557361 missense probably damaging 1.00
R6776:Hexa UTSW 9 59558072 missense probably damaging 1.00
R6805:Hexa UTSW 9 59563937 missense possibly damaging 0.55
R6912:Hexa UTSW 9 59539938 missense probably damaging 1.00
R7285:Hexa UTSW 9 59563939 missense probably benign 0.02
R7467:Hexa UTSW 9 59557400 critical splice donor site probably null
R7556:Hexa UTSW 9 59563299 missense probably damaging 1.00
R7574:Hexa UTSW 9 59563984 missense probably benign 0.22
R7614:Hexa UTSW 9 59561947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGCACGGGACAGTTATG -3'
(R):5'- CATCTACACTTTTCCCAGGGG -3'

Sequencing Primer
(F):5'- CACGGGACAGTTATGTGTAGTC -3'
(R):5'- TTTTCCCAGGGGCTCACAGAG -3'
Posted On2015-02-19