Incidental Mutation 'R3546:AA986860'
ID268189
Institutional Source Beutler Lab
Gene Symbol AA986860
Ensembl Gene ENSMUSG00000042510
Gene Nameexpressed sequence AA986860
Synonyms
MMRRC Submission 040665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3546 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130731976-130744622 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 130741189 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039323]
Predicted Effect probably benign
Transcript: ENSMUST00000039323
SMART Domains Protein: ENSMUSP00000046172
Gene: ENSMUSG00000042510

DomainStartEndE-ValueType
Pfam:SARG 33 606 1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190859
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
Bves A G 10: 45,354,811 R293G probably damaging Het
Ceacam1 T C 7: 25,471,914 N375S probably benign Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Cyth1 A G 11: 118,192,436 V46A probably damaging Het
Ddx23 G A 15: 98,650,732 T365M probably damaging Het
Etaa1 A G 11: 17,953,823 probably benign Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Hdac7 G T 15: 97,808,009 Q361K probably damaging Het
Itk A G 11: 46,355,848 L181P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mei1 A G 15: 82,098,042 Y677C probably damaging Het
Mslnl T C 17: 25,744,969 V424A probably damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr524 A G 7: 140,202,101 I223T probably damaging Het
Pdilt C A 7: 119,500,488 E186* probably null Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Sult6b1 G A 17: 78,906,907 T29I probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ush1g T A 11: 115,318,897 H157L probably damaging Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Other mutations in AA986860
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:AA986860 APN 1 130742836 missense possibly damaging 0.69
IGL01761:AA986860 APN 1 130742722 missense possibly damaging 0.70
IGL02557:AA986860 APN 1 130742707 missense probably benign 0.02
IGL03003:AA986860 APN 1 130743772 missense probably damaging 1.00
IGL02802:AA986860 UTSW 1 130743393 missense probably benign 0.00
R0326:AA986860 UTSW 1 130742898 missense possibly damaging 0.87
R0483:AA986860 UTSW 1 130743825 missense probably damaging 1.00
R0906:AA986860 UTSW 1 130737693 splice site probably benign
R0932:AA986860 UTSW 1 130737693 splice site probably null
R1522:AA986860 UTSW 1 130743094 missense probably damaging 1.00
R1762:AA986860 UTSW 1 130737688 critical splice donor site probably null
R1874:AA986860 UTSW 1 130742691 missense probably benign 0.06
R2083:AA986860 UTSW 1 130741069 missense probably damaging 1.00
R2091:AA986860 UTSW 1 130743169 missense probably benign 0.01
R2093:AA986860 UTSW 1 130743304 missense probably benign 0.13
R3915:AA986860 UTSW 1 130742607 missense probably benign
R4679:AA986860 UTSW 1 130742403 missense possibly damaging 0.67
R4703:AA986860 UTSW 1 130743355 missense probably benign 0.19
R4890:AA986860 UTSW 1 130740988 splice site probably benign
R4988:AA986860 UTSW 1 130742710 missense probably damaging 1.00
R5171:AA986860 UTSW 1 130742847 missense probably benign 0.23
R5327:AA986860 UTSW 1 130741003 missense probably damaging 1.00
R5424:AA986860 UTSW 1 130742941 missense probably damaging 1.00
R5763:AA986860 UTSW 1 130743031 missense possibly damaging 0.53
R5799:AA986860 UTSW 1 130741171 nonsense probably null
R6247:AA986860 UTSW 1 130743043 missense possibly damaging 0.78
R7124:AA986860 UTSW 1 130742887 missense possibly damaging 0.67
R7747:AA986860 UTSW 1 130743547 missense possibly damaging 0.60
Z1176:AA986860 UTSW 1 130742991 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AGCAGCTACGACTTCCTGTC -3'
(R):5'- CAGTACATGAGGTAGCCTATCAC -3'

Sequencing Primer
(F):5'- CGACTTCCTGTCTGCTGAAGAAAAG -3'
(R):5'- CATGAGGTAGCCTATCACTTTTTAAG -3'
Posted On2015-02-19