Mutagenetix > Incidental Mutations

Incidental Mutation 'R3546:AA986860'

268189

Institutional Source

Beutler Lab

Gene Symbol

AA986860

Ensembl Gene

ENSMUSG00000042510

Gene Name

expressed sequence AA986860

Synonyms

MMRRC Submission

040665-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R3546 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130731976-130744622 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 130741189 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000046172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039323]

Predicted Effect

probably benign
Transcript: ENSMUST00000039323

SMART Domains

Protein: ENSMUSP00000046172
Gene: ENSMUSG00000042510

Domain	Start	End	E-Value	Type
Pfam:SARG	33	606	1e-235	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186185

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188068

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190859

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

100% (31/31)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	A	G	3: 88,693,136		probably benign	Het
Bves	A	G	10: 45,354,811	R293G	probably damaging	Het
Ceacam1	T	C	7: 25,471,914	N375S	probably benign	Het
Celf3	T	G	3: 94,488,538	C304G	probably damaging	Het
Clcc1	T	A	3: 108,668,113	C169S	probably benign	Het
Cyth1	A	G	11: 118,192,436	V46A	probably damaging	Het
Ddx23	G	A	15: 98,650,732	T365M	probably damaging	Het
Etaa1	A	G	11: 17,953,823		probably benign	Het
Fap	A	C	2: 62,519,011	L478R	probably damaging	Het
Golga7b	T	C	19: 42,267,071	M129T	possibly damaging	Het
Hdac7	G	T	15: 97,808,009	Q361K	probably damaging	Het
Itk	A	G	11: 46,355,848	L181P	probably benign	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Lrp1b	A	T	2: 40,600,288	L287H	probably damaging	Het
Mei1	A	G	15: 82,098,042	Y677C	probably damaging	Het
Mslnl	T	C	17: 25,744,969	V424A	probably damaging	Het
Nbeal1	T	C	1: 60,278,780	F1959L	probably damaging	Het
Nlrp6	T	G	7: 140,926,769	V849G	probably benign	Het
Olfr524	A	G	7: 140,202,101	I223T	probably damaging	Het
Pdilt	C	A	7: 119,500,488	E186*	probably null	Het
Ppp1r27	T	A	11: 120,550,685	I90F	probably damaging	Het
Reln	A	G	5: 22,227,600	V134A	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc16a7	T	A	10: 125,294,700	K39*	probably null	Het
Sult6b1	G	A	17: 78,906,907	T29I	probably benign	Het
Tbc1d1	G	A	5: 64,286,007	R523Q	probably damaging	Het
Ttn	T	A	2: 76,745,106	I25148F	probably damaging	Het
Ush1g	T	A	11: 115,318,897	H157L	probably damaging	Het
Utp20	T	C	10: 88,782,689	K1150E	probably damaging	Het
Vmn1r7	A	G	6: 57,024,849	I142T	possibly damaging	Het

Other mutations in AA986860

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:AA986860	APN	1	130742836	missense	possibly damaging	0.69
IGL01761:AA986860	APN	1	130742722	missense	possibly damaging	0.70
IGL02557:AA986860	APN	1	130742707	missense	probably benign	0.02
IGL03003:AA986860	APN	1	130743772	missense	probably damaging	1.00
IGL02802:AA986860	UTSW	1	130743393	missense	probably benign	0.00
R0326:AA986860	UTSW	1	130742898	missense	possibly damaging	0.87
R0483:AA986860	UTSW	1	130743825	missense	probably damaging	1.00
R0906:AA986860	UTSW	1	130737693	splice site	probably benign
R0932:AA986860	UTSW	1	130737693	splice site	probably null
R1522:AA986860	UTSW	1	130743094	missense	probably damaging	1.00
R1762:AA986860	UTSW	1	130737688	critical splice donor site	probably null
R1874:AA986860	UTSW	1	130742691	missense	probably benign	0.06
R2083:AA986860	UTSW	1	130741069	missense	probably damaging	1.00
R2091:AA986860	UTSW	1	130743169	missense	probably benign	0.01
R2093:AA986860	UTSW	1	130743304	missense	probably benign	0.13
R3915:AA986860	UTSW	1	130742607	missense	probably benign
R4679:AA986860	UTSW	1	130742403	missense	possibly damaging	0.67
R4703:AA986860	UTSW	1	130743355	missense	probably benign	0.19
R4890:AA986860	UTSW	1	130740988	splice site	probably benign
R4988:AA986860	UTSW	1	130742710	missense	probably damaging	1.00
R5171:AA986860	UTSW	1	130742847	missense	probably benign	0.23
R5327:AA986860	UTSW	1	130741003	missense	probably damaging	1.00
R5424:AA986860	UTSW	1	130742941	missense	probably damaging	1.00
R5763:AA986860	UTSW	1	130743031	missense	possibly damaging	0.53
R5799:AA986860	UTSW	1	130741171	nonsense	probably null
R6247:AA986860	UTSW	1	130743043	missense	possibly damaging	0.78
R7124:AA986860	UTSW	1	130742887	missense	possibly damaging	0.67
R7747:AA986860	UTSW	1	130743547	missense	possibly damaging	0.60
Z1176:AA986860	UTSW	1	130742991	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- AGCAGCTACGACTTCCTGTC -3'
(R):5'- CAGTACATGAGGTAGCCTATCAC -3'

Sequencing Primer
(F):5'- CGACTTCCTGTCTGCTGAAGAAAAG -3'
(R):5'- CATGAGGTAGCCTATCACTTTTTAAG -3'

Posted On

2015-02-19