Incidental Mutation 'R3546:2810403A07Rik'
ID268194
Institutional Source Beutler Lab
Gene Symbol 2810403A07Rik
Ensembl Gene ENSMUSG00000028060
Gene NameRIKEN cDNA 2810403A07 gene
Synonyms
MMRRC Submission 040665-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R3546 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88685803-88712924 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 88693136 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029696] [ENSMUST00000198042] [ENSMUST00000198078] [ENSMUST00000199684]
Predicted Effect probably benign
Transcript: ENSMUST00000029696
SMART Domains Protein: ENSMUSP00000029696
Gene: ENSMUSG00000028060

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 2e-28 BLAST
PDB:2YQR|A 229 340 6e-76 PDB
Blast:KH 233 319 1e-36 BLAST
SCOP:d1k1ga_ 233 327 4e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
low complexity region 499 510 N/A INTRINSIC
low complexity region 566 579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197479
Predicted Effect probably benign
Transcript: ENSMUST00000198042
SMART Domains Protein: ENSMUSP00000142773
Gene: ENSMUSG00000028060

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 7e-29 BLAST
PDB:2YQR|A 229 340 2e-77 PDB
Blast:KH 233 319 2e-37 BLAST
SCOP:d1k1ga_ 233 327 3e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198078
SMART Domains Protein: ENSMUSP00000142760
Gene: ENSMUSG00000028060

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 5e-29 BLAST
PDB:2YQR|A 229 340 1e-77 PDB
Blast:KH 233 319 3e-37 BLAST
SCOP:d1k1ga_ 233 327 4e-17 SMART
low complexity region 410 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198589
Predicted Effect probably benign
Transcript: ENSMUST00000199684
SMART Domains Protein: ENSMUSP00000142353
Gene: ENSMUSG00000028060

DomainStartEndE-ValueType
low complexity region 21 66 N/A INTRINSIC
Blast:KH 103 185 7e-29 BLAST
PDB:2YQR|A 229 340 2e-77 PDB
Blast:KH 233 319 2e-37 BLAST
SCOP:d1k1ga_ 233 327 3e-16 SMART
low complexity region 344 384 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
low complexity region 442 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200364
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,741,189 probably benign Het
Bves A G 10: 45,354,811 R293G probably damaging Het
Ceacam1 T C 7: 25,471,914 N375S probably benign Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Cyth1 A G 11: 118,192,436 V46A probably damaging Het
Ddx23 G A 15: 98,650,732 T365M probably damaging Het
Etaa1 A G 11: 17,953,823 probably benign Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Hdac7 G T 15: 97,808,009 Q361K probably damaging Het
Itk A G 11: 46,355,848 L181P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mei1 A G 15: 82,098,042 Y677C probably damaging Het
Mslnl T C 17: 25,744,969 V424A probably damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr524 A G 7: 140,202,101 I223T probably damaging Het
Pdilt C A 7: 119,500,488 E186* probably null Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Sult6b1 G A 17: 78,906,907 T29I probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ush1g T A 11: 115,318,897 H157L probably damaging Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Other mutations in 2810403A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0085:2810403A07Rik UTSW 3 88711739 missense probably damaging 0.99
R0271:2810403A07Rik UTSW 3 88686329 splice site probably benign
R1160:2810403A07Rik UTSW 3 88708862 missense probably damaging 0.99
R2348:2810403A07Rik UTSW 3 88708876 missense probably benign 0.01
R3121:2810403A07Rik UTSW 3 88689292 missense probably damaging 1.00
R3548:2810403A07Rik UTSW 3 88693136 splice site probably benign
R4688:2810403A07Rik UTSW 3 88686517 missense probably damaging 1.00
R5249:2810403A07Rik UTSW 3 88696725 missense probably damaging 1.00
R5393:2810403A07Rik UTSW 3 88696606 missense probably benign 0.08
R5558:2810403A07Rik UTSW 3 88693096 missense probably damaging 0.98
R5579:2810403A07Rik UTSW 3 88700275 missense probably benign
R5782:2810403A07Rik UTSW 3 88711678 missense probably damaging 0.96
R5809:2810403A07Rik UTSW 3 88708885 missense probably damaging 0.96
R6415:2810403A07Rik UTSW 3 88699972 missense probably benign 0.25
R6566:2810403A07Rik UTSW 3 88711654 missense probably damaging 0.99
R6765:2810403A07Rik UTSW 3 88686429 missense probably damaging 1.00
R6939:2810403A07Rik UTSW 3 88686517 missense probably damaging 1.00
R7248:2810403A07Rik UTSW 3 88693579 missense probably damaging 1.00
R7311:2810403A07Rik UTSW 3 88711695 missense probably damaging 0.96
R7852:2810403A07Rik UTSW 3 88696736 missense probably benign 0.06
R7935:2810403A07Rik UTSW 3 88696736 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TAAAGGCAGGTTCTCTATGGGC -3'
(R):5'- CACAGCTCTGTCACTAGAGTAGTTAC -3'

Sequencing Primer
(F):5'- GGCTTTAGGGAATCAAATTCAGGTC -3'
(R):5'- ATACCAAAGAAGGAATGGACTAATGC -3'
Posted On2015-02-19