Incidental Mutation 'R3546:Clcc1'
ID268196
Institutional Source Beutler Lab
Gene Symbol Clcc1
Ensembl Gene ENSMUSG00000027884
Gene Namechloride channel CLIC-like 1
SynonymsMclc
MMRRC Submission 040665-MU
Accession Numbers

Ncbi RefSeq: NM_001177770.1, NM_145543.2, NM_001177771.1; MGI:2385186

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3546 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108653913-108678840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108668113 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 169 (C169S)
Ref Sequence ENSEMBL: ENSMUSP00000102224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029483] [ENSMUST00000106609] [ENSMUST00000106613] [ENSMUST00000124384]
Predicted Effect probably benign
Transcript: ENSMUST00000029483
AA Change: C164S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029483
Gene: ENSMUSG00000027884
AA Change: C164S

DomainStartEndE-ValueType
Pfam:MCLC 3 539 2e-266 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106609
AA Change: C164S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102220
Gene: ENSMUSG00000027884
AA Change: C164S

DomainStartEndE-ValueType
Pfam:MCLC 3 539 2e-266 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106613
AA Change: C169S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102224
Gene: ENSMUSG00000027884
AA Change: C169S

DomainStartEndE-ValueType
Pfam:MCLC 8 544 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124384
SMART Domains Protein: ENSMUSP00000118529
Gene: ENSMUSG00000027884

DomainStartEndE-ValueType
Pfam:MCLC 3 84 4.2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156811
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation show strain-dependent cerebellar granule cell death and peripheral motor axon degeneration. The peripheral neuropathy, neurogenic muscular atrophy and mild truncal ataxia observed on the C57BL/6J background is not found on the C3H/HeSnJ background. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted(1) Gene trapped(11)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
AA986860 A G 1: 130,741,189 probably benign Het
Bves A G 10: 45,354,811 R293G probably damaging Het
Ceacam1 T C 7: 25,471,914 N375S probably benign Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Cyth1 A G 11: 118,192,436 V46A probably damaging Het
Ddx23 G A 15: 98,650,732 T365M probably damaging Het
Etaa1 A G 11: 17,953,823 probably benign Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Hdac7 G T 15: 97,808,009 Q361K probably damaging Het
Itk A G 11: 46,355,848 L181P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mei1 A G 15: 82,098,042 Y677C probably damaging Het
Mslnl T C 17: 25,744,969 V424A probably damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr524 A G 7: 140,202,101 I223T probably damaging Het
Pdilt C A 7: 119,500,488 E186* probably null Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Sult6b1 G A 17: 78,906,907 T29I probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ush1g T A 11: 115,318,897 H157L probably damaging Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Other mutations in Clcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Clcc1 APN 3 108670903 missense probably benign 0.04
IGL01683:Clcc1 APN 3 108676796 missense probably benign 0.00
IGL02067:Clcc1 APN 3 108668721 missense probably damaging 0.99
IGL02341:Clcc1 APN 3 108673383 missense possibly damaging 0.60
B6584:Clcc1 UTSW 3 108672913 missense probably damaging 1.00
R0014:Clcc1 UTSW 3 108661396 nonsense probably null
R0733:Clcc1 UTSW 3 108674740 missense probably benign 0.00
R1151:Clcc1 UTSW 3 108668043 missense probably damaging 1.00
R1432:Clcc1 UTSW 3 108668102 missense probably benign 0.11
R3547:Clcc1 UTSW 3 108668113 missense probably benign 0.00
R3548:Clcc1 UTSW 3 108668113 missense probably benign 0.00
R3932:Clcc1 UTSW 3 108673366 missense probably damaging 1.00
R4210:Clcc1 UTSW 3 108663591 missense possibly damaging 0.90
R4211:Clcc1 UTSW 3 108663591 missense possibly damaging 0.90
R4756:Clcc1 UTSW 3 108672920 splice site probably null
R4856:Clcc1 UTSW 3 108676838 missense probably benign 0.02
R4886:Clcc1 UTSW 3 108676838 missense probably benign 0.02
R5858:Clcc1 UTSW 3 108661428 missense probably damaging 1.00
R6258:Clcc1 UTSW 3 108673308 missense possibly damaging 0.73
R6301:Clcc1 UTSW 3 108673366 missense probably damaging 1.00
R6414:Clcc1 UTSW 3 108676851 missense possibly damaging 0.90
R6944:Clcc1 UTSW 3 108670968 missense probably damaging 1.00
R6965:Clcc1 UTSW 3 108673309 missense probably damaging 0.99
R7331:Clcc1 UTSW 3 108668078 missense probably damaging 1.00
R8009:Clcc1 UTSW 3 108661458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGTAACTGACGTAGCCTG -3'
(R):5'- AGCAGTGAAACAGCCCTAAG -3'

Sequencing Primer
(F):5'- CTGACGTAGCCTGATGAGAAC -3'
(R):5'- CAGCTTCAGATGAAATGACCTG -3'
Posted On2015-02-19