Incidental Mutation 'R3546:Olfr524'
ID268202
Institutional Source Beutler Lab
Gene Symbol Olfr524
Ensembl Gene ENSMUSG00000050366
Gene Nameolfactory receptor 524
SynonymsGA_x6K02T2PBJ9-42354580-42353624, MOR103-14P
MMRRC Submission 040665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3546 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140198499-140205964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140202101 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 223 (I223T)
Ref Sequence ENSEMBL: ENSMUSP00000150970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051943] [ENSMUST00000215815]
Predicted Effect probably damaging
Transcript: ENSMUST00000051943
AA Change: I223T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053565
Gene: ENSMUSG00000050366
AA Change: I223T

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 7.5e-56 PFAM
Pfam:7tm_1 42 292 6.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215815
AA Change: I223T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7340 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
AA986860 A G 1: 130,741,189 probably benign Het
Bves A G 10: 45,354,811 R293G probably damaging Het
Ceacam1 T C 7: 25,471,914 N375S probably benign Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Cyth1 A G 11: 118,192,436 V46A probably damaging Het
Ddx23 G A 15: 98,650,732 T365M probably damaging Het
Etaa1 A G 11: 17,953,823 probably benign Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Hdac7 G T 15: 97,808,009 Q361K probably damaging Het
Itk A G 11: 46,355,848 L181P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mei1 A G 15: 82,098,042 Y677C probably damaging Het
Mslnl T C 17: 25,744,969 V424A probably damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Pdilt C A 7: 119,500,488 E186* probably null Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Sult6b1 G A 17: 78,906,907 T29I probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ush1g T A 11: 115,318,897 H157L probably damaging Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Other mutations in Olfr524
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01991:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL01999:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL02005:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL02030:Olfr524 APN 7 140202632 missense probably damaging 0.97
IGL02474:Olfr524 APN 7 140202587 missense probably damaging 1.00
H8441:Olfr524 UTSW 7 140201958 missense possibly damaging 0.81
R0426:Olfr524 UTSW 7 140202116 missense possibly damaging 0.81
R0704:Olfr524 UTSW 7 140202635 missense probably benign 0.00
R0891:Olfr524 UTSW 7 140202459 missense probably damaging 1.00
R1624:Olfr524 UTSW 7 140201951 missense probably damaging 0.96
R1865:Olfr524 UTSW 7 140202372 missense probably damaging 1.00
R1938:Olfr524 UTSW 7 140202231 missense probably benign 0.30
R2105:Olfr524 UTSW 7 140202743 missense probably benign 0.02
R3009:Olfr524 UTSW 7 140202756 missense probably benign
R4849:Olfr524 UTSW 7 140202427 nonsense probably null
R5009:Olfr524 UTSW 7 140201838 missense probably benign
R5105:Olfr524 UTSW 7 140202549 missense probably damaging 1.00
R5413:Olfr524 UTSW 7 140202722 missense possibly damaging 0.94
R5422:Olfr524 UTSW 7 140202392 missense probably damaging 1.00
R7314:Olfr524 UTSW 7 140202413 missense probably damaging 0.99
R7338:Olfr524 UTSW 7 140202533 missense probably benign 0.01
V1662:Olfr524 UTSW 7 140201958 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCTGCTGTACCTTATGTAGCG -3'
(R):5'- TCTCGTCTAGGCTACTGTGG -3'

Sequencing Primer
(F):5'- TGTGAGCACTGTGTAGACAAC -3'
(R):5'- TACTGTGGCCCCAACGTCATG -3'
Posted On2015-02-19