Incidental Mutation 'R3546:Bves'
ID268205
Institutional Source Beutler Lab
Gene Symbol Bves
Ensembl Gene ENSMUSG00000071317
Gene Nameblood vessel epicardial substance
SynonymsPopdc1, popeye 1
MMRRC Submission 040665-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3546 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location45335772-45372479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45354811 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 293 (R293G)
Ref Sequence ENSEMBL: ENSMUSP00000093382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095715]
Predicted Effect probably damaging
Transcript: ENSMUST00000095715
AA Change: R293G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093382
Gene: ENSMUSG00000071317
AA Change: R293G

DomainStartEndE-ValueType
Pfam:Popeye 40 267 3e-90 PFAM
low complexity region 313 323 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213557
Meta Mutation Damage Score 0.2643 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POP family of proteins containing three putative transmembrane domains. This gene is expressed in cardiac and skeletal muscle and may play an important role in development of these tissues. The mouse ortholog may be involved in the regeneration of adult skeletal muscle and may act as a cell adhesion molecule in coronary vasculogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in delayed muscle regeneration following induced injury. Mice homozygous for a knock-out allele exhibit sinus brachycardia in response to physical or mental stress and catecholamines with a compact sinoatrial node. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
AA986860 A G 1: 130,741,189 probably benign Het
Ceacam1 T C 7: 25,471,914 N375S probably benign Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Cyth1 A G 11: 118,192,436 V46A probably damaging Het
Ddx23 G A 15: 98,650,732 T365M probably damaging Het
Etaa1 A G 11: 17,953,823 probably benign Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Hdac7 G T 15: 97,808,009 Q361K probably damaging Het
Itk A G 11: 46,355,848 L181P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mei1 A G 15: 82,098,042 Y677C probably damaging Het
Mslnl T C 17: 25,744,969 V424A probably damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr524 A G 7: 140,202,101 I223T probably damaging Het
Pdilt C A 7: 119,500,488 E186* probably null Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Sult6b1 G A 17: 78,906,907 T29I probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ush1g T A 11: 115,318,897 H157L probably damaging Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Other mutations in Bves
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Bves APN 10 45353848 missense probably damaging 1.00
IGL01155:Bves APN 10 45353859 missense probably damaging 1.00
IGL01482:Bves APN 10 45354806 missense possibly damaging 0.68
R1402:Bves UTSW 10 45347865 missense probably damaging 1.00
R1402:Bves UTSW 10 45347865 missense probably damaging 1.00
R1564:Bves UTSW 10 45369281 missense probably benign 0.03
R1711:Bves UTSW 10 45347865 missense probably damaging 1.00
R1742:Bves UTSW 10 45347865 missense probably damaging 1.00
R2057:Bves UTSW 10 45343135 missense probably damaging 1.00
R3113:Bves UTSW 10 45343052 missense probably benign 0.01
R4400:Bves UTSW 10 45369293 missense probably benign
R4612:Bves UTSW 10 45339277 missense probably benign 0.01
R4687:Bves UTSW 10 45354840 splice site probably null
R6994:Bves UTSW 10 45339418 missense probably benign
R7052:Bves UTSW 10 45346290 missense possibly damaging 0.69
R7179:Bves UTSW 10 45354817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTTAGAGCAATTGATCACTCCC -3'
(R):5'- TATCAAACACAGGGGCATCC -3'

Sequencing Primer
(F):5'- AGAGCAATTGATCACTCCCTTTTTCG -3'
(R):5'- AAACACAGGGGCATCCTTTTCTCTAG -3'
Posted On2015-02-19