Incidental Mutation 'R3546:Bves'
ID 268205
Institutional Source Beutler Lab
Gene Symbol Bves
Ensembl Gene ENSMUSG00000071317
Gene Name blood vessel epicardial substance
Synonyms Popdc1, popeye 1
MMRRC Submission 040665-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3546 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 45211868-45248575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45230907 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 293 (R293G)
Ref Sequence ENSEMBL: ENSMUSP00000093382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095715]
AlphaFold Q9ES83
Predicted Effect probably damaging
Transcript: ENSMUST00000095715
AA Change: R293G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093382
Gene: ENSMUSG00000071317
AA Change: R293G

DomainStartEndE-ValueType
Pfam:Popeye 40 267 3e-90 PFAM
low complexity region 313 323 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213557
Meta Mutation Damage Score 0.2643 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POP family of proteins containing three putative transmembrane domains. This gene is expressed in cardiac and skeletal muscle and may play an important role in development of these tissues. The mouse ortholog may be involved in the regeneration of adult skeletal muscle and may act as a cell adhesion molecule in coronary vasculogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in delayed muscle regeneration following induced injury. Mice homozygous for a knock-out allele exhibit sinus brachycardia in response to physical or mental stress and catecholamines with a compact sinoatrial node. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,668,926 (GRCm39) probably benign Het
Ceacam1 T C 7: 25,171,339 (GRCm39) N375S probably benign Het
Celf3 T G 3: 94,395,845 (GRCm39) C304G probably damaging Het
Clcc1 T A 3: 108,575,429 (GRCm39) C169S probably benign Het
Cyth1 A G 11: 118,083,262 (GRCm39) V46A probably damaging Het
Ddx23 G A 15: 98,548,613 (GRCm39) T365M probably damaging Het
Etaa1 A G 11: 17,903,823 (GRCm39) probably benign Het
Fap A C 2: 62,349,355 (GRCm39) L478R probably damaging Het
Golga7b T C 19: 42,255,510 (GRCm39) M129T possibly damaging Het
Hdac7 G T 15: 97,705,890 (GRCm39) Q361K probably damaging Het
Itk A G 11: 46,246,675 (GRCm39) L181P probably benign Het
Kdm1b C T 13: 47,216,553 (GRCm39) R308W probably damaging Het
Khdc4 A G 3: 88,600,443 (GRCm39) probably benign Het
Lrp1b A T 2: 40,490,300 (GRCm39) L287H probably damaging Het
Mei1 A G 15: 81,982,243 (GRCm39) Y677C probably damaging Het
Mslnl T C 17: 25,963,943 (GRCm39) V424A probably damaging Het
Nbeal1 T C 1: 60,317,939 (GRCm39) F1959L probably damaging Het
Nlrp6 T G 7: 140,506,682 (GRCm39) V849G probably benign Het
Or6b13 A G 7: 139,782,014 (GRCm39) I223T probably damaging Het
Pdilt C A 7: 119,099,711 (GRCm39) E186* probably null Het
Ppp1r27 T A 11: 120,441,511 (GRCm39) I90F probably damaging Het
Reln A G 5: 22,432,598 (GRCm39) V134A possibly damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Slc16a7 T A 10: 125,130,569 (GRCm39) K39* probably null Het
Sult6b1 G A 17: 79,214,336 (GRCm39) T29I probably benign Het
Tbc1d1 G A 5: 64,443,350 (GRCm39) R523Q probably damaging Het
Ttn T A 2: 76,575,450 (GRCm39) I25148F probably damaging Het
Ush1g T A 11: 115,209,723 (GRCm39) H157L probably damaging Het
Utp20 T C 10: 88,618,551 (GRCm39) K1150E probably damaging Het
Vmn1r7 A G 6: 57,001,834 (GRCm39) I142T possibly damaging Het
Other mutations in Bves
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Bves APN 10 45,229,944 (GRCm39) missense probably damaging 1.00
IGL01155:Bves APN 10 45,229,955 (GRCm39) missense probably damaging 1.00
IGL01482:Bves APN 10 45,230,902 (GRCm39) missense possibly damaging 0.68
R1402:Bves UTSW 10 45,223,961 (GRCm39) missense probably damaging 1.00
R1402:Bves UTSW 10 45,223,961 (GRCm39) missense probably damaging 1.00
R1564:Bves UTSW 10 45,245,377 (GRCm39) missense probably benign 0.03
R1711:Bves UTSW 10 45,223,961 (GRCm39) missense probably damaging 1.00
R1742:Bves UTSW 10 45,223,961 (GRCm39) missense probably damaging 1.00
R2057:Bves UTSW 10 45,219,231 (GRCm39) missense probably damaging 1.00
R3113:Bves UTSW 10 45,219,148 (GRCm39) missense probably benign 0.01
R4400:Bves UTSW 10 45,245,389 (GRCm39) missense probably benign
R4612:Bves UTSW 10 45,215,373 (GRCm39) missense probably benign 0.01
R4687:Bves UTSW 10 45,230,936 (GRCm39) splice site probably null
R6994:Bves UTSW 10 45,215,514 (GRCm39) missense probably benign
R7052:Bves UTSW 10 45,222,386 (GRCm39) missense possibly damaging 0.69
R7179:Bves UTSW 10 45,230,913 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTTAGAGCAATTGATCACTCCC -3'
(R):5'- TATCAAACACAGGGGCATCC -3'

Sequencing Primer
(F):5'- AGAGCAATTGATCACTCCCTTTTTCG -3'
(R):5'- AAACACAGGGGCATCCTTTTCTCTAG -3'
Posted On 2015-02-19