Mutagenetix > Incidental Mutation

Incidental Mutation 'R3546:Itk'

268208

Institutional Source

Beutler Lab

Gene Symbol

Itk

Ensembl Gene

ENSMUSG00000020395

Gene Name

IL2 inducible T cell kinase

Synonyms

Emt, Tsk, Tcsk

MMRRC Submission

040665-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R3546 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46325150-46389515 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46355848 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 181 (L181P)

Ref Sequence

ENSEMBL: ENSMUSP00000104860 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000101306] [ENSMUST00000109237]

AlphaFold

Q03526

PDB Structure

INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<

Predicted Effect

probably benign
Transcript: ENSMUST00000020664
AA Change: L175P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395
AA Change: L175P

Domain	Start	End	E-Value	Type
PH	5	113	2.3e-13	SMART
BTK	113	149	1.1e-21	SMART
SH3	174	230	5.87e-14	SMART
SH2	237	328	9.44e-29	SMART
TyrKc	362	611	3.28e-133	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000101306
AA Change: L175P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000098864
Gene: ENSMUSG00000020395
AA Change: L175P

Domain	Start	End	E-Value	Type
PH	5	113	2.3e-13	SMART
BTK	113	149	1.1e-21	SMART
SH3	174	230	5.87e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109237
AA Change: L181P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395
AA Change: L181P

Domain	Start	End	E-Value	Type
PH	5	119	3.94e-12	SMART
BTK	119	155	1.1e-21	SMART
SH3	180	236	5.87e-14	SMART
SH2	243	334	9.44e-29	SMART
TyrKc	368	617	3.28e-133	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	A	G	3: 88,693,136		probably benign	Het
AA986860	A	G	1: 130,741,189		probably benign	Het
Bves	A	G	10: 45,354,811	R293G	probably damaging	Het
Ceacam1	T	C	7: 25,471,914	N375S	probably benign	Het
Celf3	T	G	3: 94,488,538	C304G	probably damaging	Het
Clcc1	T	A	3: 108,668,113	C169S	probably benign	Het
Cyth1	A	G	11: 118,192,436	V46A	probably damaging	Het
Ddx23	G	A	15: 98,650,732	T365M	probably damaging	Het
Etaa1	A	G	11: 17,953,823		probably benign	Het
Fap	A	C	2: 62,519,011	L478R	probably damaging	Het
Golga7b	T	C	19: 42,267,071	M129T	possibly damaging	Het
Hdac7	G	T	15: 97,808,009	Q361K	probably damaging	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Lrp1b	A	T	2: 40,600,288	L287H	probably damaging	Het
Mei1	A	G	15: 82,098,042	Y677C	probably damaging	Het
Mslnl	T	C	17: 25,744,969	V424A	probably damaging	Het
Nbeal1	T	C	1: 60,278,780	F1959L	probably damaging	Het
Nlrp6	T	G	7: 140,926,769	V849G	probably benign	Het
Olfr524	A	G	7: 140,202,101	I223T	probably damaging	Het
Pdilt	C	A	7: 119,500,488	E186*	probably null	Het
Ppp1r27	T	A	11: 120,550,685	I90F	probably damaging	Het
Reln	A	G	5: 22,227,600	V134A	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc16a7	T	A	10: 125,294,700	K39*	probably null	Het
Sult6b1	G	A	17: 78,906,907	T29I	probably benign	Het
Tbc1d1	G	A	5: 64,286,007	R523Q	probably damaging	Het
Ttn	T	A	2: 76,745,106	I25148F	probably damaging	Het
Ush1g	T	A	11: 115,318,897	H157L	probably damaging	Het
Utp20	T	C	10: 88,782,689	K1150E	probably damaging	Het
Vmn1r7	A	G	6: 57,024,849	I142T	possibly damaging	Het

Other mutations in Itk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Itk	APN	11	46367896	missense	probably damaging	1.00
IGL01349:Itk	APN	11	46341200	missense	possibly damaging	0.84
IGL03290:Itk	APN	11	46334937	missense	probably damaging	1.00
IGL03385:Itk	APN	11	46331861	nonsense	probably null
Calame	UTSW	11	46342395	splice site	probably null
carbone	UTSW	11	46331949	nonsense	probably null
demon	UTSW	11	46340712	missense	probably damaging	1.00
goodnow	UTSW	11	46338099	splice site	probably null
itxaro	UTSW	11	46338217	missense	probably damaging	1.00
Segun	UTSW	11	46344883	intron	probably benign
BB009:Itk	UTSW	11	46340692	missense	probably benign
BB019:Itk	UTSW	11	46340692	missense	probably benign
R0095:Itk	UTSW	11	46342452	missense	probably damaging	0.99
R0265:Itk	UTSW	11	46389458	start gained	probably benign
R0281:Itk	UTSW	11	46353916	missense	probably damaging	1.00
R0463:Itk	UTSW	11	46331989	missense	probably damaging	1.00
R0518:Itk	UTSW	11	46360288	missense	probably damaging	0.98
R0521:Itk	UTSW	11	46360288	missense	probably damaging	0.98
R1121:Itk	UTSW	11	46331894	missense	possibly damaging	0.93
R1550:Itk	UTSW	11	46389326	missense	probably damaging	1.00
R1762:Itk	UTSW	11	46336482	missense	probably damaging	0.98
R2418:Itk	UTSW	11	46338217	missense	probably damaging	1.00
R2419:Itk	UTSW	11	46338217	missense	probably damaging	1.00
R2859:Itk	UTSW	11	46344835	intron	probably benign
R3107:Itk	UTSW	11	46327464	missense	probably benign	0.15
R4601:Itk	UTSW	11	46336515	missense	probably benign	0.17
R4610:Itk	UTSW	11	46336515	missense	probably benign	0.17
R4792:Itk	UTSW	11	46344831	intron	probably benign
R4885:Itk	UTSW	11	46336344	splice site	probably null
R4934:Itk	UTSW	11	46389325	missense	probably damaging	1.00
R5286:Itk	UTSW	11	46338099	splice site	probably null
R5328:Itk	UTSW	11	46331876	missense	probably benign	0.04
R5399:Itk	UTSW	11	46338111	missense	probably benign	0.44
R5958:Itk	UTSW	11	46344855	intron	probably benign
R6235:Itk	UTSW	11	46336428	missense	probably benign	0.16
R6828:Itk	UTSW	11	46341218	missense	probably damaging	1.00
R6849:Itk	UTSW	11	46331935	missense	probably damaging	1.00
R7356:Itk	UTSW	11	46367832	missense	possibly damaging	0.72
R7753:Itk	UTSW	11	46331895	missense	probably damaging	1.00
R7932:Itk	UTSW	11	46340692	missense	probably benign
R7988:Itk	UTSW	11	46355834	missense	probably damaging	0.99
R8188:Itk	UTSW	11	46331949	nonsense	probably null
R8337:Itk	UTSW	11	46342395	splice site	probably null
R8738:Itk	UTSW	11	46340712	missense	probably damaging	1.00
R8993:Itk	UTSW	11	46334908	missense	probably damaging	1.00
R9028:Itk	UTSW	11	46344883	intron	probably benign
R9650:Itk	UTSW	11	46331951	missense	probably damaging	1.00
U24488:Itk	UTSW	11	46338144	missense	probably damaging	1.00
X0062:Itk	UTSW	11	46366044	missense	probably benign	0.15
Z1088:Itk	UTSW	11	46353862	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GGCATTCCTTCCCATAGTCG -3'
(R):5'- CTCGCAGAATGCAGGAAGTG -3'

Sequencing Primer
(F):5'- ATAGTCGTTTTGTTCCCACAGTAG -3'
(R):5'- AACTCACACATAATGCCTACTTGATG -3'

Posted On

2015-02-19