Incidental Mutation 'R3546:Cyth1'
ID268209
Institutional Source Beutler Lab
Gene Symbol Cyth1
Ensembl Gene ENSMUSG00000017132
Gene Namecytohesin 1
SynonymsCTH-1, Pscd1, CLM1
MMRRC Submission 040665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R3546 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118132019-118248592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118192436 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 46 (V46A)
Ref Sequence ENSEMBL: ENSMUSP00000114792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017276] [ENSMUST00000100181] [ENSMUST00000106302] [ENSMUST00000106305] [ENSMUST00000151165]
Predicted Effect probably benign
Transcript: ENSMUST00000017276
AA Change: V44A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000017276
Gene: ENSMUSG00000017132
AA Change: V44A

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 378 4.8e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100181
AA Change: V58A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097756
Gene: ENSMUSG00000017132
AA Change: V58A

DomainStartEndE-ValueType
Sec7 73 258 1.38e-108 SMART
PH 275 392 1.65e-23 SMART
low complexity region 402 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106302
AA Change: V46A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101909
Gene: ENSMUSG00000017132
AA Change: V46A

DomainStartEndE-ValueType
Sec7 61 246 1.38e-108 SMART
PH 263 381 4.18e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106305
AA Change: V44A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000101912
Gene: ENSMUSG00000017132
AA Change: V44A

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 379 4.18e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141243
Predicted Effect probably damaging
Transcript: ENSMUST00000151165
AA Change: V46A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114792
Gene: ENSMUSG00000017132
AA Change: V46A

DomainStartEndE-ValueType
SCOP:d1pbv__ 55 99 4e-15 SMART
PDB:1BC9|A 60 99 9e-21 PDB
Blast:Sec7 61 99 1e-20 BLAST
Meta Mutation Damage Score 0.0993 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal brain morphology and long term potentiation. Mice homozygous for a knock-out allele exhibit decreased myelin sheath thickness due to hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
AA986860 A G 1: 130,741,189 probably benign Het
Bves A G 10: 45,354,811 R293G probably damaging Het
Ceacam1 T C 7: 25,471,914 N375S probably benign Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Ddx23 G A 15: 98,650,732 T365M probably damaging Het
Etaa1 A G 11: 17,953,823 probably benign Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Hdac7 G T 15: 97,808,009 Q361K probably damaging Het
Itk A G 11: 46,355,848 L181P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mei1 A G 15: 82,098,042 Y677C probably damaging Het
Mslnl T C 17: 25,744,969 V424A probably damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr524 A G 7: 140,202,101 I223T probably damaging Het
Pdilt C A 7: 119,500,488 E186* probably null Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Sult6b1 G A 17: 78,906,907 T29I probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ush1g T A 11: 115,318,897 H157L probably damaging Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Other mutations in Cyth1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Cyth1 APN 11 118193613 critical splice donor site probably null
IGL02047:Cyth1 APN 11 118169132 missense probably damaging 1.00
IGL02658:Cyth1 APN 11 118182246 missense probably damaging 0.99
IGL02826:Cyth1 APN 11 118185481 missense possibly damaging 0.89
Mucilage UTSW 11 118170860 missense probably damaging 1.00
Stuck UTSW 11 118185759 critical splice donor site probably null
tarred UTSW 11 118183923 nonsense probably null
R0109:Cyth1 UTSW 11 118182306 missense probably damaging 0.98
R0109:Cyth1 UTSW 11 118182306 missense probably damaging 0.98
R0470:Cyth1 UTSW 11 118132248 unclassified probably benign
R1387:Cyth1 UTSW 11 118182346 unclassified probably benign
R1599:Cyth1 UTSW 11 118177221 missense probably damaging 0.99
R2098:Cyth1 UTSW 11 118193653 missense probably damaging 1.00
R2156:Cyth1 UTSW 11 118182808 missense probably damaging 1.00
R4300:Cyth1 UTSW 11 118183894 missense probably damaging 0.98
R4589:Cyth1 UTSW 11 118184985 missense possibly damaging 0.70
R4799:Cyth1 UTSW 11 118183942 missense probably damaging 1.00
R5165:Cyth1 UTSW 11 118169082 missense possibly damaging 0.82
R5524:Cyth1 UTSW 11 118182767 missense probably benign 0.27
R5834:Cyth1 UTSW 11 118192463 critical splice acceptor site probably null
R5933:Cyth1 UTSW 11 118185759 critical splice donor site probably null
R5960:Cyth1 UTSW 11 118132367 unclassified probably benign
R6609:Cyth1 UTSW 11 118170860 missense probably damaging 1.00
R7014:Cyth1 UTSW 11 118212651 missense probably benign
R7108:Cyth1 UTSW 11 118182913 missense probably damaging 0.99
R7237:Cyth1 UTSW 11 118185495 missense probably damaging 1.00
R7401:Cyth1 UTSW 11 118182251 missense possibly damaging 0.94
R7424:Cyth1 UTSW 11 118184009 splice site probably null
R7523:Cyth1 UTSW 11 118183923 nonsense probably null
R7574:Cyth1 UTSW 11 118182863 missense probably damaging 1.00
R7647:Cyth1 UTSW 11 118177288 missense probably benign 0.00
R7731:Cyth1 UTSW 11 118169053 missense possibly damaging 0.55
R7848:Cyth1 UTSW 11 118183923 nonsense probably null
R7849:Cyth1 UTSW 11 118183923 nonsense probably null
R7931:Cyth1 UTSW 11 118183923 nonsense probably null
R7932:Cyth1 UTSW 11 118183923 nonsense probably null
X0063:Cyth1 UTSW 11 118132329 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCTATGTCCAGATCCTTGCAG -3'
(R):5'- AGACATACTCTTCTTGCTGACCTG -3'

Sequencing Primer
(F):5'- TCCAGATCCTTGCAGTGAGG -3'
(R):5'- ATACTCTTCTTGCTGACCTGGTAGG -3'
Posted On2015-02-19