Incidental Mutation 'R3546:Ddx23'
ID268214
Institutional Source Beutler Lab
Gene Symbol Ddx23
Ensembl Gene ENSMUSG00000003360
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Synonyms
MMRRC Submission 040665-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3546 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98645134-98662894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98650732 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 365 (T365M)
Ref Sequence ENSEMBL: ENSMUSP00000003450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003450]
Predicted Effect probably damaging
Transcript: ENSMUST00000003450
AA Change: T365M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003450
Gene: ENSMUSG00000003360
AA Change: T365M

DomainStartEndE-ValueType
coiled coil region 63 93 N/A INTRINSIC
low complexity region 110 130 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 161 200 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
coiled coil region 320 352 N/A INTRINSIC
DEXDc 409 641 2.95e-65 SMART
HELICc 677 758 2.43e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161030
Meta Mutation Damage Score 0.3367 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the U5 snRNP complex; it may facilitate conformational changes in the spliceosome during nuclear pre-mRNA splicing. An alternatively spliced transcript variant has been found for this gene, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
AA986860 A G 1: 130,741,189 probably benign Het
Bves A G 10: 45,354,811 R293G probably damaging Het
Ceacam1 T C 7: 25,471,914 N375S probably benign Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Cyth1 A G 11: 118,192,436 V46A probably damaging Het
Etaa1 A G 11: 17,953,823 probably benign Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Hdac7 G T 15: 97,808,009 Q361K probably damaging Het
Itk A G 11: 46,355,848 L181P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mei1 A G 15: 82,098,042 Y677C probably damaging Het
Mslnl T C 17: 25,744,969 V424A probably damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr524 A G 7: 140,202,101 I223T probably damaging Het
Pdilt C A 7: 119,500,488 E186* probably null Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Sult6b1 G A 17: 78,906,907 T29I probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ush1g T A 11: 115,318,897 H157L probably damaging Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Other mutations in Ddx23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Ddx23 APN 15 98650940 missense probably benign 0.02
IGL02320:Ddx23 APN 15 98650938 missense possibly damaging 0.68
IGL02325:Ddx23 APN 15 98647193 missense possibly damaging 0.80
IGL02456:Ddx23 APN 15 98647549 missense probably damaging 1.00
IGL02514:Ddx23 APN 15 98658318 missense unknown
IGL03173:Ddx23 APN 15 98651004 missense probably benign 0.31
R0077:Ddx23 UTSW 15 98656600 critical splice donor site probably null
R1930:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R1931:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R1932:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R4174:Ddx23 UTSW 15 98658251 missense unknown
R4574:Ddx23 UTSW 15 98647624 missense probably damaging 1.00
R4728:Ddx23 UTSW 15 98650225 missense probably damaging 1.00
R4774:Ddx23 UTSW 15 98647235 missense probably benign 0.00
R4811:Ddx23 UTSW 15 98647471 splice site probably null
R5134:Ddx23 UTSW 15 98650770 missense possibly damaging 0.48
R5895:Ddx23 UTSW 15 98651951 missense probably benign 0.00
R5952:Ddx23 UTSW 15 98658240 missense unknown
R6012:Ddx23 UTSW 15 98650770 missense possibly damaging 0.48
R6289:Ddx23 UTSW 15 98649884 missense probably benign 0.05
R6705:Ddx23 UTSW 15 98652968 nonsense probably null
R7289:Ddx23 UTSW 15 98648611 missense probably damaging 0.98
R7484:Ddx23 UTSW 15 98648689 missense probably damaging 0.99
R7543:Ddx23 UTSW 15 98658258 missense unknown
R7740:Ddx23 UTSW 15 98658434 start codon destroyed probably null
Z1088:Ddx23 UTSW 15 98647621 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GTCCCAACTACATTTGCAGTCC -3'
(R):5'- GCAGTCACGTTTCTATGGAGAC -3'

Sequencing Primer
(F):5'- CTACATTTGCAGTCCTAGAACGTAG -3'
(R):5'- CACGTTTCTATGGAGACCTGATG -3'
Posted On2015-02-19