Incidental Mutation 'R3547:Thnsl1'
ID268222
Institutional Source Beutler Lab
Gene Symbol Thnsl1
Ensembl Gene ENSMUSG00000048550
Gene Namethreonine synthase-like 1 (bacterial)
Synonyms
MMRRC Submission 040666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3547 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location21205724-21215009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 21212627 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 397 (D397E)
Ref Sequence ENSEMBL: ENSMUSP00000052452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054591] [ENSMUST00000102951] [ENSMUST00000102952] [ENSMUST00000138914] [ENSMUST00000138965]
Predicted Effect probably benign
Transcript: ENSMUST00000054591
AA Change: D397E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000052452
Gene: ENSMUSG00000048550
AA Change: D397E

DomainStartEndE-ValueType
Pfam:AAA_17 57 202 2e-8 PFAM
Pfam:SKI 64 221 5.8e-40 PFAM
Pfam:Thr_synth_N 230 318 3.2e-16 PFAM
Pfam:PALP 326 659 2.2e-9 PFAM
low complexity region 684 701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102951
SMART Domains Protein: ENSMUSP00000100016
Gene: ENSMUSG00000048550

DomainStartEndE-ValueType
PDB:1KL7|B 2 158 2e-27 PDB
SCOP:d1kl7a_ 2 214 7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102952
SMART Domains Protein: ENSMUSP00000100017
Gene: ENSMUSG00000048550

DomainStartEndE-ValueType
PDB:1KL7|B 2 158 2e-27 PDB
SCOP:d1kl7a_ 2 214 7e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138914
Predicted Effect probably benign
Transcript: ENSMUST00000138965
SMART Domains Protein: ENSMUSP00000115186
Gene: ENSMUSG00000048550

DomainStartEndE-ValueType
PDB:1KL7|B 2 93 5e-16 PDB
Meta Mutation Damage Score 0.3742 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik C A 15: 74,881,614 A18S probably null Het
Alg5 A G 3: 54,749,315 R316G probably benign Het
Anapc1 T C 2: 128,642,682 N1121D possibly damaging Het
Antxr2 A T 5: 97,977,657 I247N probably benign Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl9 A G 5: 77,010,479 D136G probably benign Het
Atxn1l A G 8: 109,732,349 L427P possibly damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clec4a3 A G 6: 122,964,280 E78G probably damaging Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Col12a1 T G 9: 79,633,416 K2429T probably damaging Het
Col20a1 G T 2: 180,994,911 E228D probably damaging Het
Cx3cl1 A C 8: 94,778,124 E56A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Grid2 T C 6: 64,320,021 V456A probably damaging Het
Gstcd G T 3: 133,084,838 T56K possibly damaging Het
Hydin G A 8: 110,582,067 G3995D possibly damaging Het
Igkv4-50 G A 6: 69,700,781 T113I probably benign Het
Igkv5-45 A G 6: 69,776,256 probably benign Het
Igsf10 G A 3: 59,330,541 H740Y probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Lcmt1 A G 7: 123,400,479 E94G probably benign Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Map3k3 C T 11: 106,142,553 Q211* probably null Het
Map4 T A 9: 110,052,198 F43L possibly damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Mylk G A 16: 34,880,168 V460I possibly damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr549 A G 7: 102,554,470 Y62C probably damaging Het
Pi4k2a C T 19: 42,090,548 P16L probably benign Het
Pitx3 T A 19: 46,136,109 Q273L possibly damaging Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Prickle2 T C 6: 92,411,137 Y428C probably damaging Het
Prkcq A G 2: 11,283,816 K527E probably benign Het
Prune2 T A 19: 17,124,348 S2405R probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rnf167 T C 11: 70,649,681 I129T possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfxn2 T C 19: 46,590,196 S217P probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Slc22a17 A G 14: 54,907,237 L573P probably damaging Het
Slc25a45 T C 19: 5,884,546 Y181H probably damaging Het
Slc6a20a A G 9: 123,660,502 S159P probably damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ube4b T C 4: 149,335,116 D1045G probably damaging Het
Ugt8a A T 3: 125,867,382 L487* probably null Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Uty A C Y: 1,158,512 D463E possibly damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Vps13d T G 4: 145,074,975 T3558P probably damaging Het
Zfp319 A G 8: 95,328,817 S253P probably damaging Het
Zfp831 A G 2: 174,657,683 S1265G probably benign Het
Other mutations in Thnsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Thnsl1 APN 2 21212449 missense possibly damaging 0.47
IGL00756:Thnsl1 APN 2 21212612 missense probably benign 0.02
IGL00952:Thnsl1 APN 2 21211956 missense possibly damaging 0.89
IGL01020:Thnsl1 APN 2 21212494 missense probably damaging 0.99
IGL01350:Thnsl1 APN 2 21212200 missense probably benign 0.30
IGL01476:Thnsl1 APN 2 21212159 missense probably benign 0.00
IGL01548:Thnsl1 APN 2 21213132 missense probably damaging 1.00
IGL01916:Thnsl1 APN 2 21212665 missense possibly damaging 0.66
IGL02176:Thnsl1 APN 2 21211854 missense possibly damaging 0.69
IGL03001:Thnsl1 APN 2 21211644 missense probably damaging 0.99
IGL03219:Thnsl1 APN 2 21212406 missense probably benign 0.14
IGL03386:Thnsl1 APN 2 21211548 missense probably benign 0.01
R0684:Thnsl1 UTSW 2 21211666 missense probably benign 0.02
R0738:Thnsl1 UTSW 2 21213362 missense probably damaging 1.00
R1119:Thnsl1 UTSW 2 21213046 missense probably damaging 1.00
R1121:Thnsl1 UTSW 2 21212164 missense probably benign 0.00
R2150:Thnsl1 UTSW 2 21212533 missense probably benign 0.08
R3545:Thnsl1 UTSW 2 21212627 missense probably benign 0.01
R4244:Thnsl1 UTSW 2 21212248 missense probably benign
R4245:Thnsl1 UTSW 2 21212248 missense probably benign
R4510:Thnsl1 UTSW 2 21212425 missense probably damaging 0.99
R4511:Thnsl1 UTSW 2 21212425 missense probably damaging 0.99
R4678:Thnsl1 UTSW 2 21211541 splice site probably null
R4753:Thnsl1 UTSW 2 21213364 missense probably damaging 1.00
R4795:Thnsl1 UTSW 2 21212045 nonsense probably null
R4796:Thnsl1 UTSW 2 21212045 nonsense probably null
R5584:Thnsl1 UTSW 2 21213412 missense probably damaging 1.00
R5586:Thnsl1 UTSW 2 21212390 nonsense probably null
R5682:Thnsl1 UTSW 2 21212068 missense possibly damaging 0.69
R5718:Thnsl1 UTSW 2 21212000 missense possibly damaging 0.54
R6159:Thnsl1 UTSW 2 21212205 nonsense probably null
R6795:Thnsl1 UTSW 2 21213492 nonsense probably null
R7084:Thnsl1 UTSW 2 21212330 missense possibly damaging 0.69
R7153:Thnsl1 UTSW 2 21212953 missense possibly damaging 0.64
R7243:Thnsl1 UTSW 2 21212847 missense probably damaging 1.00
R7265:Thnsl1 UTSW 2 21212458 missense probably damaging 1.00
R7481:Thnsl1 UTSW 2 21211788 missense probably benign 0.00
R8005:Thnsl1 UTSW 2 21211944 missense probably benign
R8223:Thnsl1 UTSW 2 21212113 missense probably benign 0.45
R8331:Thnsl1 UTSW 2 21212174 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCACCTTTCTGGCAATCAG -3'
(R):5'- TTGTTCCATATTCCACAGCCAG -3'

Sequencing Primer
(F):5'- CTGGCAATCAGTTCATCTTGGAG -3'
(R):5'- GTTCCATATTCCACAGCCAGAAAGC -3'
Posted On2015-02-19