Mutagenetix > Incidental Mutation

Incidental Mutation 'R3547:Anapc1'

268229

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

MMRRC Submission

040666-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3547 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128642682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 1121 (N1121D)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]

AlphaFold

P53995

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014499
AA Change: N1121D

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: N1121D

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110333
AA Change: N1121D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: N1121D

Domain	Start	End	E-Value	Type
Pfam:Apc1	149	227	1.7e-22	PFAM
low complexity region	323	345	N/A	INTRINSIC

Meta Mutation Damage Score

0.0981

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010109I03Rik	C	A	15: 74,881,614	A18S	probably null	Het
Alg5	A	G	3: 54,749,315	R316G	probably benign	Het
Antxr2	A	T	5: 97,977,657	I247N	probably benign	Het
Arid5b	C	T	10: 68,098,462	G294S	probably benign	Het
Arl9	A	G	5: 77,010,479	D136G	probably benign	Het
Atxn1l	A	G	8: 109,732,349	L427P	possibly damaging	Het
Celf3	T	G	3: 94,488,538	C304G	probably damaging	Het
Clcc1	T	A	3: 108,668,113	C169S	probably benign	Het
Clec4a3	A	G	6: 122,964,280	E78G	probably damaging	Het
Clip1	A	G	5: 123,631,078	L532P	probably damaging	Het
Col12a1	T	G	9: 79,633,416	K2429T	probably damaging	Het
Col20a1	G	T	2: 180,994,911	E228D	probably damaging	Het
Cx3cl1	A	C	8: 94,778,124	E56A	possibly damaging	Het
Eprs	G	A	1: 185,379,742		probably null	Het
Fap	A	C	2: 62,519,011	L478R	probably damaging	Het
Fhit	T	C	14: 9,870,095	T125A	probably benign	Het
Gdi1	T	A	X: 74,307,808	F175L	possibly damaging	Het
Golga7b	T	C	19: 42,267,071	M129T	possibly damaging	Het
Gpr149	A	T	3: 62,595,128	C436S	probably benign	Het
Grid2	T	C	6: 64,320,021	V456A	probably damaging	Het
Gstcd	G	T	3: 133,084,838	T56K	possibly damaging	Het
Hydin	G	A	8: 110,582,067	G3995D	possibly damaging	Het
Igkv4-50	G	A	6: 69,700,781	T113I	probably benign	Het
Igkv5-45	A	G	6: 69,776,256		probably benign	Het
Igsf10	G	A	3: 59,330,541	H740Y	probably benign	Het
Igsf10	C	A	3: 59,336,514	R133L	probably damaging	Het
Lcmt1	A	G	7: 123,400,479	E94G	probably benign	Het
Lrp1b	A	T	2: 40,600,288	L287H	probably damaging	Het
Map3k3	C	T	11: 106,142,553	Q211*	probably null	Het
Map4	T	A	9: 110,052,198	F43L	possibly damaging	Het
Mcf2	T	C	X: 60,135,446	K74R	probably damaging	Het
Mylk	G	A	16: 34,880,168	V460I	possibly damaging	Het
Nat1	A	G	8: 67,491,032	D23G	possibly damaging	Het
Nbeal1	T	C	1: 60,278,780	F1959L	probably damaging	Het
Ncf1	T	A	5: 134,226,609	K143*	probably null	Het
Nlrp6	T	G	7: 140,926,769	V849G	probably benign	Het
Olfr549	A	G	7: 102,554,470	Y62C	probably damaging	Het
Pi4k2a	C	T	19: 42,090,548	P16L	probably benign	Het
Pitx3	T	A	19: 46,136,109	Q273L	possibly damaging	Het
Ppp1r27	T	A	11: 120,550,685	I90F	probably damaging	Het
Prickle2	T	C	6: 92,411,137	Y428C	probably damaging	Het
Prkcq	A	G	2: 11,283,816	K527E	probably benign	Het
Prune2	T	A	19: 17,124,348	S2405R	probably damaging	Het
Reln	A	G	5: 22,227,600	V134A	possibly damaging	Het
Rnf167	T	C	11: 70,649,681	I129T	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sfxn2	T	C	19: 46,590,196	S217P	probably damaging	Het
Slc16a7	T	A	10: 125,294,700	K39*	probably null	Het
Slc22a17	A	G	14: 54,907,237	L573P	probably damaging	Het
Slc25a45	T	C	19: 5,884,546	Y181H	probably damaging	Het
Slc6a20a	A	G	9: 123,660,502	S159P	probably damaging	Het
Tbc1d1	G	A	5: 64,286,007	R523Q	probably damaging	Het
Thnsl1	T	G	2: 21,212,627	D397E	probably benign	Het
Ttn	T	A	2: 76,745,106	I25148F	probably damaging	Het
Ube4b	T	C	4: 149,335,116	D1045G	probably damaging	Het
Ugt8a	A	T	3: 125,867,382	L487*	probably null	Het
Uprt	T	A	X: 104,483,328	L123H	probably damaging	Het
Usp9x	T	C	X: 13,128,390	L940P	probably benign	Het
Utp20	T	C	10: 88,782,689	K1150E	probably damaging	Het
Uty	A	C	Y: 1,158,512	D463E	possibly damaging	Het
Vmn1r7	A	G	6: 57,024,849	I142T	possibly damaging	Het
Vps13d	T	G	4: 145,074,975	T3558P	probably damaging	Het
Zfp319	A	G	8: 95,328,817	S253P	probably damaging	Het
Zfp831	A	G	2: 174,657,683	S1265G	probably benign	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128634711	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128641340	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128669043	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128659788	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128633415	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128676249	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5063:Anapc1	UTSW	2	128629549	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128672135	nonsense	probably null
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7041:Anapc1	UTSW	2	128628656	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128674602	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128623502	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128622500	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128617722	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128634678	missense	probably benign
R9436:Anapc1	UTSW	2	128676125	missense	probably benign
R9516:Anapc1	UTSW	2	128675713	missense	possibly damaging	0.77
R9563:Anapc1	UTSW	2	128664060	nonsense	probably null
R9572:Anapc1	UTSW	2	128664056	missense	probably benign
R9757:Anapc1	UTSW	2	128675756	missense	probably damaging	1.00
R9766:Anapc1	UTSW	2	128658301	missense	probably damaging	1.00
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TGAGAAAGCCGGCATACTC -3'
(R):5'- GTGTGTTAACAAAATGGACCCTG -3'

Sequencing Primer
(F):5'- GGCATACTCATTGGCTAACTCAG -3'
(R):5'- TGGGAAGTAAATCTCAGCCCTCTG -3'

Posted On

2015-02-19