Incidental Mutation 'R3547:Ugt8a'
ID268238
Institutional Source Beutler Lab
Gene Symbol Ugt8a
Ensembl Gene ENSMUSG00000032854
Gene NameUDP galactosyltransferase 8A
SynonymsmCerGT, Cgt, Ugt8
MMRRC Submission 040666-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R3547 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location125865271-125938619 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 125867382 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 487 (L487*)
Ref Sequence ENSEMBL: ENSMUSP00000143605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057944] [ENSMUST00000198610]
Predicted Effect probably null
Transcript: ENSMUST00000057944
AA Change: L487*
SMART Domains Protein: ENSMUSP00000050852
Gene: ENSMUSG00000032854
AA Change: L487*

DomainStartEndE-ValueType
Pfam:UDPGT 21 510 4.2e-121 PFAM
Pfam:Glyco_tran_28_C 326 437 6.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198610
AA Change: L487*
SMART Domains Protein: ENSMUSP00000143605
Gene: ENSMUSG00000032854
AA Change: L487*

DomainStartEndE-ValueType
Pfam:UDPGT 21 510 4.2e-121 PFAM
Pfam:Glyco_tran_28_C 326 437 6.4e-9 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UDP-glycosyltransferase family. It catalyzes the transfer of galactose to ceramide, a key enzymatic step in the biosynthesis of galactocerebrosides, which are abundant sphingolipids of the myelin membrane of the central and peripheral nervous systems. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutants fail to make galactolipid galactocerebroside and its sulfated derivative that are normal myelin constituents. Mutants have tremors, ataxia, progressive hindlimb paralysis and vacuole formation in ventral spinal cord due to abnormal myelin sheath. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik C A 15: 74,881,614 A18S probably null Het
Alg5 A G 3: 54,749,315 R316G probably benign Het
Anapc1 T C 2: 128,642,682 N1121D possibly damaging Het
Antxr2 A T 5: 97,977,657 I247N probably benign Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl9 A G 5: 77,010,479 D136G probably benign Het
Atxn1l A G 8: 109,732,349 L427P possibly damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clec4a3 A G 6: 122,964,280 E78G probably damaging Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Col12a1 T G 9: 79,633,416 K2429T probably damaging Het
Col20a1 G T 2: 180,994,911 E228D probably damaging Het
Cx3cl1 A C 8: 94,778,124 E56A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Grid2 T C 6: 64,320,021 V456A probably damaging Het
Gstcd G T 3: 133,084,838 T56K possibly damaging Het
Hydin G A 8: 110,582,067 G3995D possibly damaging Het
Igkv4-50 G A 6: 69,700,781 T113I probably benign Het
Igkv5-45 A G 6: 69,776,256 probably benign Het
Igsf10 G A 3: 59,330,541 H740Y probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Lcmt1 A G 7: 123,400,479 E94G probably benign Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Map3k3 C T 11: 106,142,553 Q211* probably null Het
Map4 T A 9: 110,052,198 F43L possibly damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Mylk G A 16: 34,880,168 V460I possibly damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr549 A G 7: 102,554,470 Y62C probably damaging Het
Pi4k2a C T 19: 42,090,548 P16L probably benign Het
Pitx3 T A 19: 46,136,109 Q273L possibly damaging Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Prickle2 T C 6: 92,411,137 Y428C probably damaging Het
Prkcq A G 2: 11,283,816 K527E probably benign Het
Prune2 T A 19: 17,124,348 S2405R probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rnf167 T C 11: 70,649,681 I129T possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfxn2 T C 19: 46,590,196 S217P probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Slc22a17 A G 14: 54,907,237 L573P probably damaging Het
Slc25a45 T C 19: 5,884,546 Y181H probably damaging Het
Slc6a20a A G 9: 123,660,502 S159P probably damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Thnsl1 T G 2: 21,212,627 D397E probably benign Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ube4b T C 4: 149,335,116 D1045G probably damaging Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Uty A C Y: 1,158,512 D463E possibly damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Vps13d T G 4: 145,074,975 T3558P probably damaging Het
Zfp319 A G 8: 95,328,817 S253P probably damaging Het
Zfp831 A G 2: 174,657,683 S1265G probably benign Het
Other mutations in Ugt8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ugt8a APN 3 125914636 critical splice donor site probably null
IGL01934:Ugt8a APN 3 125914775 missense probably benign 0.18
IGL02435:Ugt8a APN 3 125867320 missense probably benign 0.00
IGL03050:Ugt8a UTSW 3 125875490 missense possibly damaging 0.63
R0041:Ugt8a UTSW 3 125915090 missense probably benign 0.00
R0453:Ugt8a UTSW 3 125914957 missense probably benign 0.03
R1314:Ugt8a UTSW 3 125871748 missense probably benign 0.00
R1544:Ugt8a UTSW 3 125915449 missense probably benign 0.06
R1566:Ugt8a UTSW 3 125875558 missense probably damaging 0.96
R1770:Ugt8a UTSW 3 125874203 missense probably benign 0.11
R2126:Ugt8a UTSW 3 125875546 missense probably damaging 0.98
R2972:Ugt8a UTSW 3 125915308 missense probably benign
R2973:Ugt8a UTSW 3 125915308 missense probably benign
R3906:Ugt8a UTSW 3 125914982 missense possibly damaging 0.95
R3907:Ugt8a UTSW 3 125914982 missense possibly damaging 0.95
R4032:Ugt8a UTSW 3 125874158 missense probably damaging 1.00
R5235:Ugt8a UTSW 3 125867480 missense probably damaging 1.00
R5890:Ugt8a UTSW 3 125875553 missense probably benign 0.01
R6790:Ugt8a UTSW 3 125871691 missense possibly damaging 0.93
R6937:Ugt8a UTSW 3 125915601 start gained probably benign
R7298:Ugt8a UTSW 3 125915416 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGAATAGCACTACAGACTTGGC -3'
(R):5'- GCAGAGGGCTCAGAAGTTATC -3'

Sequencing Primer
(F):5'- ACCTGGGCTGTCGGATCATC -3'
(R):5'- GGCTCAGAAGTTATCGGAAATTCAC -3'
Posted On2015-02-19