Incidental Mutation 'R3547:Prickle2'
ID268250
Institutional Source Beutler Lab
Gene Symbol Prickle2
Ensembl Gene ENSMUSG00000030020
Gene Nameprickle planar cell polarity protein 2
Synonyms6230400G14Rik, mpk2, 6720451F06Rik
MMRRC Submission 040666-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R3547 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location92370908-92706155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92411137 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 428 (Y428C)
Ref Sequence ENSEMBL: ENSMUSP00000109074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032093] [ENSMUST00000113445] [ENSMUST00000113446] [ENSMUST00000113447]
Predicted Effect probably damaging
Transcript: ENSMUST00000032093
AA Change: Y484C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032093
Gene: ENSMUSG00000030020
AA Change: Y484C

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:PET 76 176 1.2e-45 PFAM
LIM 185 242 3.05e-10 SMART
LIM 250 302 5.43e-16 SMART
LIM 310 365 2.92e-7 SMART
low complexity region 465 477 N/A INTRINSIC
low complexity region 534 546 N/A INTRINSIC
low complexity region 725 753 N/A INTRINSIC
low complexity region 832 841 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113445
AA Change: Y428C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109072
Gene: ENSMUSG00000030020
AA Change: Y428C

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113446
AA Change: Y428C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109073
Gene: ENSMUSG00000030020
AA Change: Y428C

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113447
AA Change: Y428C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109074
Gene: ENSMUSG00000030020
AA Change: Y428C

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Meta Mutation Damage Score 0.0900 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homolog of Drosophila prickle. The exact function of this gene is not known, however, studies in mice suggest that it may be involved in seizure prevention. Mutations in this gene are associated with progressive myoclonic epilepsy type 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive or PTZ-induced seizures. Mice heterozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik C A 15: 74,881,614 A18S probably null Het
Alg5 A G 3: 54,749,315 R316G probably benign Het
Anapc1 T C 2: 128,642,682 N1121D possibly damaging Het
Antxr2 A T 5: 97,977,657 I247N probably benign Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl9 A G 5: 77,010,479 D136G probably benign Het
Atxn1l A G 8: 109,732,349 L427P possibly damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clec4a3 A G 6: 122,964,280 E78G probably damaging Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Col12a1 T G 9: 79,633,416 K2429T probably damaging Het
Col20a1 G T 2: 180,994,911 E228D probably damaging Het
Cx3cl1 A C 8: 94,778,124 E56A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Grid2 T C 6: 64,320,021 V456A probably damaging Het
Gstcd G T 3: 133,084,838 T56K possibly damaging Het
Hydin G A 8: 110,582,067 G3995D possibly damaging Het
Igkv4-50 G A 6: 69,700,781 T113I probably benign Het
Igkv5-45 A G 6: 69,776,256 probably benign Het
Igsf10 G A 3: 59,330,541 H740Y probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Lcmt1 A G 7: 123,400,479 E94G probably benign Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Map3k3 C T 11: 106,142,553 Q211* probably null Het
Map4 T A 9: 110,052,198 F43L possibly damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Mylk G A 16: 34,880,168 V460I possibly damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr549 A G 7: 102,554,470 Y62C probably damaging Het
Pi4k2a C T 19: 42,090,548 P16L probably benign Het
Pitx3 T A 19: 46,136,109 Q273L possibly damaging Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Prkcq A G 2: 11,283,816 K527E probably benign Het
Prune2 T A 19: 17,124,348 S2405R probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rnf167 T C 11: 70,649,681 I129T possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfxn2 T C 19: 46,590,196 S217P probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Slc22a17 A G 14: 54,907,237 L573P probably damaging Het
Slc25a45 T C 19: 5,884,546 Y181H probably damaging Het
Slc6a20a A G 9: 123,660,502 S159P probably damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Thnsl1 T G 2: 21,212,627 D397E probably benign Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ube4b T C 4: 149,335,116 D1045G probably damaging Het
Ugt8a A T 3: 125,867,382 L487* probably null Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Uty A C Y: 1,158,512 D463E possibly damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Vps13d T G 4: 145,074,975 T3558P probably damaging Het
Zfp319 A G 8: 95,328,817 S253P probably damaging Het
Zfp831 A G 2: 174,657,683 S1265G probably benign Het
Other mutations in Prickle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02962:Prickle2 APN 6 92376422 missense probably benign 0.00
R0028:Prickle2 UTSW 6 92422342 missense probably benign 0.12
R0122:Prickle2 UTSW 6 92411345 nonsense probably null
R0555:Prickle2 UTSW 6 92458565 missense probably benign 0.02
R0940:Prickle2 UTSW 6 92411003 missense probably benign 0.02
R1394:Prickle2 UTSW 6 92376382 missense possibly damaging 0.87
R1470:Prickle2 UTSW 6 92458602 missense probably damaging 0.96
R1470:Prickle2 UTSW 6 92458602 missense probably damaging 0.96
R1599:Prickle2 UTSW 6 92410874 missense probably benign
R1745:Prickle2 UTSW 6 92376593 missense probably damaging 1.00
R1801:Prickle2 UTSW 6 92416904 missense probably damaging 0.98
R1985:Prickle2 UTSW 6 92411452 missense probably damaging 1.00
R2085:Prickle2 UTSW 6 92376364 missense probably damaging 0.96
R2147:Prickle2 UTSW 6 92425671 missense probably damaging 0.99
R2148:Prickle2 UTSW 6 92425671 missense probably damaging 0.99
R2571:Prickle2 UTSW 6 92705400 missense probably benign 0.09
R4356:Prickle2 UTSW 6 92411509 missense probably damaging 1.00
R4569:Prickle2 UTSW 6 92422342 missense probably benign 0.12
R4896:Prickle2 UTSW 6 92416755 missense probably benign 0.26
R5004:Prickle2 UTSW 6 92416755 missense probably benign 0.26
R5045:Prickle2 UTSW 6 92376394 missense probably damaging 0.96
R5219:Prickle2 UTSW 6 92376530 missense probably benign
R5247:Prickle2 UTSW 6 92375969 missense probably damaging 1.00
R5280:Prickle2 UTSW 6 92376210 missense probably damaging 1.00
R5334:Prickle2 UTSW 6 92425684 missense probably damaging 1.00
R5780:Prickle2 UTSW 6 92458612 missense probably benign 0.06
R5960:Prickle2 UTSW 6 92376305 missense probably benign 0.08
R6084:Prickle2 UTSW 6 92416848 nonsense probably null
R6362:Prickle2 UTSW 6 92458615 missense possibly damaging 0.77
R6368:Prickle2 UTSW 6 92420237 missense probably damaging 1.00
R6852:Prickle2 UTSW 6 92376544 missense probably benign
R7041:Prickle2 UTSW 6 92376305 missense probably benign 0.08
R7203:Prickle2 UTSW 6 92410978 missense possibly damaging 0.61
R7352:Prickle2 UTSW 6 92410890 missense probably benign 0.00
R7405:Prickle2 UTSW 6 92458543 missense probably damaging 0.96
R7510:Prickle2 UTSW 6 92376470 missense possibly damaging 0.58
R7562:Prickle2 UTSW 6 92375948 makesense probably null
R7578:Prickle2 UTSW 6 92411290 missense probably benign 0.32
R7614:Prickle2 UTSW 6 92425650 missense possibly damaging 0.46
R7732:Prickle2 UTSW 6 92411224 missense probably damaging 1.00
X0020:Prickle2 UTSW 6 92416853 missense probably damaging 0.98
X0026:Prickle2 UTSW 6 92411426 nonsense probably null
X0066:Prickle2 UTSW 6 92376433 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTCGGGTTTCATTAAAGC -3'
(R):5'- GAGTTCTAACCGGCTCTCAG -3'

Sequencing Primer
(F):5'- GGCTGGACATATCACTGTAGCTC -3'
(R):5'- TCTCAGCTGATGTGGACCC -3'
Posted On2015-02-19