Incidental Mutation 'R3547:Olfr549'
ID268253
Institutional Source Beutler Lab
Gene Symbol Olfr549
Ensembl Gene ENSMUSG00000073977
Gene Nameolfactory receptor 549
SynonymsMOR31-3, GA_x6K02T2PBJ9-5274337-5275287
MMRRC Submission 040666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3547 (G1)
Quality Score147
Status Validated
Chromosome7
Chromosomal Location102549870-102555842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102554470 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 62 (Y62C)
Ref Sequence ENSEMBL: ENSMUSP00000150373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033264] [ENSMUST00000098227] [ENSMUST00000106913] [ENSMUST00000217478]
Predicted Effect probably benign
Transcript: ENSMUST00000033264
SMART Domains Protein: ENSMUSP00000033264
Gene: ENSMUSG00000030966

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098227
AA Change: Y62C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095829
Gene: ENSMUSG00000073977
AA Change: Y62C

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.7e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 225 1.2e-11 PFAM
Pfam:7tm_1 43 294 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106913
SMART Domains Protein: ENSMUSP00000102526
Gene: ENSMUSG00000030966

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217478
AA Change: Y62C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik C A 15: 74,881,614 A18S probably null Het
Alg5 A G 3: 54,749,315 R316G probably benign Het
Anapc1 T C 2: 128,642,682 N1121D possibly damaging Het
Antxr2 A T 5: 97,977,657 I247N probably benign Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl9 A G 5: 77,010,479 D136G probably benign Het
Atxn1l A G 8: 109,732,349 L427P possibly damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clec4a3 A G 6: 122,964,280 E78G probably damaging Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Col12a1 T G 9: 79,633,416 K2429T probably damaging Het
Col20a1 G T 2: 180,994,911 E228D probably damaging Het
Cx3cl1 A C 8: 94,778,124 E56A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Grid2 T C 6: 64,320,021 V456A probably damaging Het
Gstcd G T 3: 133,084,838 T56K possibly damaging Het
Hydin G A 8: 110,582,067 G3995D possibly damaging Het
Igkv4-50 G A 6: 69,700,781 T113I probably benign Het
Igkv5-45 A G 6: 69,776,256 probably benign Het
Igsf10 G A 3: 59,330,541 H740Y probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Lcmt1 A G 7: 123,400,479 E94G probably benign Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Map3k3 C T 11: 106,142,553 Q211* probably null Het
Map4 T A 9: 110,052,198 F43L possibly damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Mylk G A 16: 34,880,168 V460I possibly damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Pi4k2a C T 19: 42,090,548 P16L probably benign Het
Pitx3 T A 19: 46,136,109 Q273L possibly damaging Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Prickle2 T C 6: 92,411,137 Y428C probably damaging Het
Prkcq A G 2: 11,283,816 K527E probably benign Het
Prune2 T A 19: 17,124,348 S2405R probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rnf167 T C 11: 70,649,681 I129T possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfxn2 T C 19: 46,590,196 S217P probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Slc22a17 A G 14: 54,907,237 L573P probably damaging Het
Slc25a45 T C 19: 5,884,546 Y181H probably damaging Het
Slc6a20a A G 9: 123,660,502 S159P probably damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Thnsl1 T G 2: 21,212,627 D397E probably benign Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ube4b T C 4: 149,335,116 D1045G probably damaging Het
Ugt8a A T 3: 125,867,382 L487* probably null Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Uty A C Y: 1,158,512 D463E possibly damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Vps13d T G 4: 145,074,975 T3558P probably damaging Het
Zfp319 A G 8: 95,328,817 S253P probably damaging Het
Zfp831 A G 2: 174,657,683 S1265G probably benign Het
Other mutations in Olfr549
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr549 APN 7 102554891 missense probably damaging 1.00
IGL02048:Olfr549 APN 7 102554883 missense probably damaging 1.00
IGL02314:Olfr549 APN 7 102555111 missense probably damaging 1.00
IGL03154:Olfr549 APN 7 102554706 missense probably benign
R0783:Olfr549 UTSW 7 102554439 missense probably benign 0.01
R2009:Olfr549 UTSW 7 102554944 missense probably damaging 1.00
R2145:Olfr549 UTSW 7 102555060 splice site probably null
R6843:Olfr549 UTSW 7 102554721 missense probably benign
R7294:Olfr549 UTSW 7 102554953 missense probably damaging 1.00
R7533:Olfr549 UTSW 7 102554511 missense probably damaging 1.00
X0018:Olfr549 UTSW 7 102554728 missense probably benign 0.00
Z1177:Olfr549 UTSW 7 102554971 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTACAAATGACCTGGCCTGG -3'
(R):5'- CCACATAGCGGTCAAATGC -3'

Sequencing Primer
(F):5'- GGTATGGCACCTTTTAACTACACAGG -3'
(R):5'- CATAGCGGTCAAATGCCATGGC -3'
Posted On2015-02-19