Incidental Mutation 'R3547:Fhit'
ID268272
Institutional Source Beutler Lab
Gene Symbol Fhit
Ensembl Gene ENSMUSG00000060579
Gene Namefragile histidine triad gene
SynonymsFra14A2
MMRRC Submission 040666-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R3547 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location9550092-11162035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9870095 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 125 (T125A)
Ref Sequence ENSEMBL: ENSMUSP00000124017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160340] [ENSMUST00000160956] [ENSMUST00000161302] [ENSMUST00000161895] [ENSMUST00000162278] [ENSMUST00000162817] [ENSMUST00000179394]
Predicted Effect probably benign
Transcript: ENSMUST00000160340
AA Change: T125A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124017
Gene: ENSMUSG00000060579
AA Change: T125A

DomainStartEndE-ValueType
Pfam:DcpS_C 60 170 2e-9 PFAM
Pfam:HIT 72 168 6.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160956
SMART Domains Protein: ENSMUSP00000123820
Gene: ENSMUSG00000060579

DomainStartEndE-ValueType
Pfam:HIT 9 57 6.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161179
Predicted Effect probably benign
Transcript: ENSMUST00000161302
AA Change: T62A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123874
Gene: ENSMUSG00000060579
AA Change: T62A

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161895
AA Change: T62A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124957
Gene: ENSMUSG00000060579
AA Change: T62A

DomainStartEndE-ValueType
Pfam:DcpS_C 6 110 4.3e-10 PFAM
Pfam:HIT 9 105 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162278
AA Change: T62A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124073
Gene: ENSMUSG00000060579
AA Change: T62A

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162817
AA Change: T62A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124500
Gene: ENSMUSG00000060579
AA Change: T62A

DomainStartEndE-ValueType
Pfam:DcpS_C 5 100 2.3e-7 PFAM
Pfam:HIT 9 100 1.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179394
AA Change: T62A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136011
Gene: ENSMUSG00000060579
AA Change: T62A

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Meta Mutation Damage Score 0.0750 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a member of the HIT family of proteins that are characterized by the presence of a histidine triad sequence. The encoded protein is a diadenosine triphosphate hydrolase enzyme that cleaves the P(1)-P(3)-bis(5'-adenosyl) triphosphate (Ap3A) to yield AMP and ADP. This locus is very fragile and has been found to be altered in different types of cancers. Mice lacking the encoded protein display increased susceptibility to spontaneous and induced tumors. Ectopic expression of the encoded protein in such knockout mice inhibits tumor development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Both homozygotes and heterozygotes for a targeted null mutation exhibit a similarly increased incidence of both spontaneous and nitrosomethylbenzalamine-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik C A 15: 74,881,614 A18S probably null Het
Alg5 A G 3: 54,749,315 R316G probably benign Het
Anapc1 T C 2: 128,642,682 N1121D possibly damaging Het
Antxr2 A T 5: 97,977,657 I247N probably benign Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl9 A G 5: 77,010,479 D136G probably benign Het
Atxn1l A G 8: 109,732,349 L427P possibly damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clec4a3 A G 6: 122,964,280 E78G probably damaging Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Col12a1 T G 9: 79,633,416 K2429T probably damaging Het
Col20a1 G T 2: 180,994,911 E228D probably damaging Het
Cx3cl1 A C 8: 94,778,124 E56A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Grid2 T C 6: 64,320,021 V456A probably damaging Het
Gstcd G T 3: 133,084,838 T56K possibly damaging Het
Hydin G A 8: 110,582,067 G3995D possibly damaging Het
Igkv4-50 G A 6: 69,700,781 T113I probably benign Het
Igkv5-45 A G 6: 69,776,256 probably benign Het
Igsf10 G A 3: 59,330,541 H740Y probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Lcmt1 A G 7: 123,400,479 E94G probably benign Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Map3k3 C T 11: 106,142,553 Q211* probably null Het
Map4 T A 9: 110,052,198 F43L possibly damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Mylk G A 16: 34,880,168 V460I possibly damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr549 A G 7: 102,554,470 Y62C probably damaging Het
Pi4k2a C T 19: 42,090,548 P16L probably benign Het
Pitx3 T A 19: 46,136,109 Q273L possibly damaging Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Prickle2 T C 6: 92,411,137 Y428C probably damaging Het
Prkcq A G 2: 11,283,816 K527E probably benign Het
Prune2 T A 19: 17,124,348 S2405R probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rnf167 T C 11: 70,649,681 I129T possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfxn2 T C 19: 46,590,196 S217P probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Slc22a17 A G 14: 54,907,237 L573P probably damaging Het
Slc25a45 T C 19: 5,884,546 Y181H probably damaging Het
Slc6a20a A G 9: 123,660,502 S159P probably damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Thnsl1 T G 2: 21,212,627 D397E probably benign Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ube4b T C 4: 149,335,116 D1045G probably damaging Het
Ugt8a A T 3: 125,867,382 L487* probably null Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Uty A C Y: 1,158,512 D463E possibly damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Vps13d T G 4: 145,074,975 T3558P probably damaging Het
Zfp319 A G 8: 95,328,817 S253P probably damaging Het
Zfp831 A G 2: 174,657,683 S1265G probably benign Het
Other mutations in Fhit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Fhit APN 14 9573483 missense probably benign 0.19
IGL01412:Fhit APN 14 9870065 missense probably damaging 1.00
IGL02831:Fhit APN 14 9870080 missense probably benign 0.00
IGL03025:Fhit APN 14 10421534 missense probably damaging 1.00
overtax UTSW 14 10421534 missense probably damaging 1.00
R0464:Fhit UTSW 14 10991567 start gained probably benign
R0544:Fhit UTSW 14 9870172 missense probably damaging 1.00
R3545:Fhit UTSW 14 9870095 missense probably benign 0.03
R3548:Fhit UTSW 14 9870095 missense probably benign 0.03
R4033:Fhit UTSW 14 10751671 intron probably benign
R4685:Fhit UTSW 14 9870091 missense probably damaging 1.00
R4968:Fhit UTSW 14 10421522 missense probably damaging 1.00
R5624:Fhit UTSW 14 10421534 missense probably damaging 1.00
R6011:Fhit UTSW 14 9870068 missense probably benign 0.16
R6061:Fhit UTSW 14 9573435 missense probably benign 0.00
R6208:Fhit UTSW 14 9573435 missense probably benign 0.00
R6846:Fhit UTSW 14 9763762 missense possibly damaging 0.73
R7288:Fhit UTSW 14 9763784 missense probably damaging 1.00
R7625:Fhit UTSW 14 9870177 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGCTGTTATATAAATGCAGACCAC -3'
(R):5'- ATAGTCTGCAAGATTCCAGGCC -3'

Sequencing Primer
(F):5'- TGCAGACCACAAAAACCATTTCTCTG -3'
(R):5'- CCCAAGTCAATGGAACTCGGG -3'
Posted On2015-02-19