Mutagenetix > Incidental Mutation

Incidental Mutation 'R3548:Tnni1'

268288

Institutional Source

Beutler Lab

Gene Symbol

Tnni1

Ensembl Gene

ENSMUSG00000026418

Gene Name

troponin I, skeletal, slow 1

Synonyms

2700018B22Rik, ssTnI

MMRRC Submission

040667-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3548 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135709252-135738727 bp(+) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 135732791 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000123049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000132795] [ENSMUST00000139986] [ENSMUST00000148201] [ENSMUST00000152075] [ENSMUST00000152208] [ENSMUST00000154463]

AlphaFold

Q9WUZ5

Predicted Effect

probably benign
Transcript: ENSMUST00000129217

SMART Domains

Protein: ENSMUSP00000119848
Gene: ENSMUSG00000026418

Domain	Start	End	E-Value	Type
Pfam:Troponin	9	140	2.2e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132795
AA Change: R6G

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000121122
Gene: ENSMUSG00000026418
AA Change: R6G

Domain	Start	End	E-Value	Type
Pfam:Troponin	15	60	7.1e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137331

Predicted Effect

probably null
Transcript: ENSMUST00000139986

SMART Domains

Protein: ENSMUSP00000123049
Gene: ENSMUSG00000026418

Domain	Start	End	E-Value	Type
Pfam:Troponin	1	130	1.3e-53	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000148201
AA Change: R6G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000123509
Gene: ENSMUSG00000026418
AA Change: R6G

Domain	Start	End	E-Value	Type
Pfam:Troponin	15	146	8.1e-54	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000152075
AA Change: R6G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000121343
Gene: ENSMUSG00000026418
AA Change: R6G

Domain	Start	End	E-Value	Type
Pfam:Troponin	15	146	8.1e-54	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000152208
AA Change: R6G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000121966
Gene: ENSMUSG00000026418
AA Change: R6G

Domain	Start	End	E-Value	Type
Pfam:Troponin	15	146	8.1e-54	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000154463
AA Change: R6G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000122925
Gene: ENSMUSG00000026418
AA Change: R6G

Domain	Start	End	E-Value	Type
Pfam:Troponin	15	146	1.4e-49	PFAM

Meta Mutation Damage Score

0.2938

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 92.8%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Troponin proteins associate with tropomyosin and regulate the calcium sensitivity of the myofibril contractile apparatus of striated muscles. Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. The TnI-fast and TnI-slow genes are expressed in fast-twitch and slow-twitch skeletal muscle fibers, respectively, while the TnI-cardiac gene is expressed exclusively in cardiac muscle tissue. This gene encodes the Troponin-I-skeletal-slow-twitch protein. This gene is expressed in cardiac and skeletal muscle during early development but is restricted to slow-twitch skeletal muscle fibers in adults. The encoded protein prevents muscle contraction by inhibiting calcium-mediated conformational changes in actin-myosin complexes. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amph	C	A	13: 19,287,129 (GRCm39)	H279Q	probably damaging	Het
Ankrd28	A	G	14: 31,437,217 (GRCm39)	L646S	probably benign	Het
Bmal1	A	T	7: 112,912,752 (GRCm39)	I610F	probably damaging	Het
Celf3	T	G	3: 94,395,845 (GRCm39)	C304G	probably damaging	Het
Chrnb2	T	A	3: 89,668,898 (GRCm39)	Y139F	probably benign	Het
Clcc1	T	A	3: 108,575,429 (GRCm39)	C169S	probably benign	Het
Clip1	A	G	5: 123,769,141 (GRCm39)	L532P	probably damaging	Het
Cr2	A	T	1: 194,838,196 (GRCm39)	C1089*	probably null	Het
Dnah10	A	T	5: 124,824,694 (GRCm39)	I617F	possibly damaging	Het
F12	T	C	13: 55,565,950 (GRCm39)	N132D	probably benign	Het
Fhit	T	C	14: 9,870,095 (GRCm38)	T125A	probably benign	Het
Frs3	T	G	17: 48,014,561 (GRCm39)	I418S	probably damaging	Het
Gpr149	A	T	3: 62,502,549 (GRCm39)	C436S	probably benign	Het
Igsf10	C	A	3: 59,243,935 (GRCm39)	R133L	probably damaging	Het
Il17rb	A	G	14: 29,730,729 (GRCm39)		probably null	Het
Kdm1b	C	T	13: 47,216,553 (GRCm39)	R308W	probably damaging	Het
Khdc4	A	G	3: 88,600,443 (GRCm39)		probably benign	Het
Mtus2	C	A	5: 148,232,316 (GRCm39)	H120Q	probably damaging	Het
Muc6	G	A	7: 141,218,313 (GRCm39)	S2120F	possibly damaging	Het
Ncf1	T	A	5: 134,255,463 (GRCm39)	K143*	probably null	Het
Nes	C	A	3: 87,880,429 (GRCm39)		probably benign	Het
Nid2	T	A	14: 19,813,779 (GRCm39)	Y195N	probably damaging	Het
Nlrp9c	A	T	7: 26,070,876 (GRCm39)	C790S	probably damaging	Het
Or5b12	A	T	19: 12,897,031 (GRCm39)	I214N	probably benign	Het
Phf24	T	G	4: 42,937,879 (GRCm39)	Y85*	probably null	Het
Pycr1	T	C	11: 120,533,072 (GRCm39)	S33G	probably benign	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Sirt2	A	G	7: 28,467,096 (GRCm39)	E19G	probably damaging	Het
Sort1	T	C	3: 108,245,225 (GRCm39)	V359A	possibly damaging	Het
Ube2q1	T	A	3: 89,688,383 (GRCm39)	M183K	probably damaging	Het
Vmn1r50	T	A	6: 90,084,476 (GRCm39)	F74I	probably damaging	Het

Other mutations in Tnni1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01609:Tnni1	APN	1	135,733,234 (GRCm39)	splice site	probably null
R1758:Tnni1	UTSW	1	135,736,420 (GRCm39)	missense	probably damaging	1.00
R2035:Tnni1	UTSW	1	135,733,330 (GRCm39)	missense	probably benign	0.00
R5352:Tnni1	UTSW	1	135,733,330 (GRCm39)	missense	probably benign	0.00
R6477:Tnni1	UTSW	1	135,733,304 (GRCm39)	missense	probably benign	0.00
R7434:Tnni1	UTSW	1	135,735,260 (GRCm39)	missense
X0018:Tnni1	UTSW	1	135,736,458 (GRCm39)	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- CGCAGATGAGGAAGTACCCATG -3'
(R):5'- GGCAGGATACAACACTAGTCG -3'

Sequencing Primer
(F):5'- TACCCATGGGAGGCACATCTG -3'
(R):5'- AACACTAGTCGCCCATCAGTCTTC -3'

Posted On

2015-02-19