Incidental Mutation 'R3548:Chrnb2'
ID268294
Institutional Source Beutler Lab
Gene Symbol Chrnb2
Ensembl Gene ENSMUSG00000027950
Gene Namecholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)
SynonymsC030030P04Rik, Acrb2, Acrb-2, [b]2-nAchR
MMRRC Submission 040667-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R3548 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89746195-89764632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89761591 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 139 (Y139F)
Ref Sequence ENSEMBL: ENSMUSP00000143441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029562] [ENSMUST00000200558]
Predicted Effect probably benign
Transcript: ENSMUST00000029562
AA Change: Y139F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029562
Gene: ENSMUSG00000027950
AA Change: Y139F

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 29 234 5.6e-75 PFAM
Pfam:Neur_chan_memb 241 477 1.7e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199372
Predicted Effect probably benign
Transcript: ENSMUST00000200558
AA Change: Y139F

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000143441
Gene: ENSMUSG00000027950
AA Change: Y139F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 29 234 1.5e-71 PFAM
Pfam:Neur_chan_memb 241 454 4.8e-61 PFAM
low complexity region 657 666 N/A INTRINSIC
Meta Mutation Damage Score 0.1105 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have impaired responses to nicotine, but show improved passive avoidance behavior. With age, mutants show more neurodegeneration and alterations of the visual system, with decreased cortical visual acuity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
Amph C A 13: 19,102,959 H279Q probably damaging Het
Ankrd28 A G 14: 31,715,260 L646S probably benign Het
Arntl A T 7: 113,313,545 I610F probably damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Cr2 A T 1: 195,155,888 C1089* probably null Het
Dnah10 A T 5: 124,747,630 I617F possibly damaging Het
F12 T C 13: 55,418,137 N132D probably benign Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Frs3 T G 17: 47,703,636 I418S probably damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Il17rb A G 14: 30,008,772 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mtus2 C A 5: 148,295,506 H120Q probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nes C A 3: 87,973,122 probably benign Het
Nid2 T A 14: 19,763,711 Y195N probably damaging Het
Nlrp9c A T 7: 26,371,451 C790S probably damaging Het
Olfr1448 A T 19: 12,919,667 I214N probably benign Het
Phf24 T G 4: 42,937,879 Y85* probably null Het
Pycr1 T C 11: 120,642,246 S33G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sirt2 A G 7: 28,767,671 E19G probably damaging Het
Sort1 T C 3: 108,337,909 V359A possibly damaging Het
Tnni1 A G 1: 135,805,053 probably null Het
Ube2q1 T A 3: 89,781,076 M183K probably damaging Het
Vmn1r50 T A 6: 90,107,494 F74I probably damaging Het
Other mutations in Chrnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03108:Chrnb2 APN 3 89763374 splice site probably benign
IGL03117:Chrnb2 APN 3 89763245 missense probably damaging 1.00
IGL03391:Chrnb2 APN 3 89760877 missense probably damaging 0.98
R0131:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R0131:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R0132:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R1726:Chrnb2 UTSW 3 89761202 missense probably damaging 1.00
R2095:Chrnb2 UTSW 3 89761437 missense probably benign 0.01
R2124:Chrnb2 UTSW 3 89769341 unclassified probably benign
R4212:Chrnb2 UTSW 3 89761544 missense probably damaging 1.00
R4902:Chrnb2 UTSW 3 89760941 missense probably damaging 1.00
R6307:Chrnb2 UTSW 3 89761524 missense probably damaging 1.00
R6751:Chrnb2 UTSW 3 89761576 missense probably damaging 1.00
R6999:Chrnb2 UTSW 3 89761315 missense possibly damaging 0.71
R7318:Chrnb2 UTSW 3 89763367 critical splice acceptor site probably null
R7826:Chrnb2 UTSW 3 89763243 missense probably damaging 1.00
R8025:Chrnb2 UTSW 3 89761342 missense probably damaging 1.00
R8094:Chrnb2 UTSW 3 89761391 missense probably damaging 1.00
R8143:Chrnb2 UTSW 3 89747323 missense unknown
R8739:Chrnb2 UTSW 3 89762439 missense probably damaging 1.00
R8809:Chrnb2 UTSW 3 89757150 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTAGGTGTGAAGTCGTCCAG -3'
(R):5'- GGAGGAGACCCATTCTTACCAC -3'

Sequencing Primer
(F):5'- GGCTGGCCACATCGCTTTTG -3'
(R):5'- TTACCACCAACCTGTGAATATTCC -3'
Posted On2015-02-19