Incidental Mutation 'R3548:Celf3'
ID268296
Institutional Source Beutler Lab
Gene Symbol Celf3
Ensembl Gene ENSMUSG00000028137
Gene NameCUGBP, Elav-like family member 3
SynonymsBRUNOL1, CAGH4, 4930415M08Rik, Tnrc4, ERDA4
MMRRC Submission 040667-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R3548 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94478295-94492198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 94488538 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 304 (C304G)
Ref Sequence ENSEMBL: ENSMUSP00000142412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029784] [ENSMUST00000197558] [ENSMUST00000197677] [ENSMUST00000198316] [ENSMUST00000198384] [ENSMUST00000199775] [ENSMUST00000200342] [ENSMUST00000199884]
Predicted Effect probably damaging
Transcript: ENSMUST00000029784
AA Change: C380G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029784
Gene: ENSMUSG00000028137
AA Change: C380G

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 95 170 2.02e-19 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 248 275 N/A INTRINSIC
low complexity region 339 373 N/A INTRINSIC
RRM 381 454 8.83e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197033
Predicted Effect probably damaging
Transcript: ENSMUST00000197558
AA Change: C285G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143733
Gene: ENSMUSG00000028137
AA Change: C285G

DomainStartEndE-ValueType
RRM 19 94 8.9e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
RRM 286 359 3.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197677
SMART Domains Protein: ENSMUSP00000143089
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198067
Predicted Effect probably damaging
Transcript: ENSMUST00000198316
AA Change: C304G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142412
Gene: ENSMUSG00000028137
AA Change: C304G

DomainStartEndE-ValueType
RRM 19 94 8.7e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
low complexity region 263 297 N/A INTRINSIC
RRM 305 378 3.6e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198384
SMART Domains Protein: ENSMUSP00000142542
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199159
Predicted Effect probably damaging
Transcript: ENSMUST00000199775
AA Change: C331G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143532
Gene: ENSMUSG00000028137
AA Change: C331G

DomainStartEndE-ValueType
RRM 8 84 1.9e-21 SMART
RRM 96 171 8.9e-22 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 290 324 N/A INTRINSIC
RRM 332 405 3.7e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200342
AA Change: C409G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143344
Gene: ENSMUSG00000028137
AA Change: C409G

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 96 171 2.02e-19 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 249 276 N/A INTRINSIC
low complexity region 368 402 N/A INTRINSIC
RRM 410 483 8.83e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199884
Meta Mutation Damage Score 0.3443 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Male mice homozygous for a null mutation display reduced sperm counts and motility but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
Amph C A 13: 19,102,959 H279Q probably damaging Het
Ankrd28 A G 14: 31,715,260 L646S probably benign Het
Arntl A T 7: 113,313,545 I610F probably damaging Het
Chrnb2 T A 3: 89,761,591 Y139F probably benign Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Cr2 A T 1: 195,155,888 C1089* probably null Het
Dnah10 A T 5: 124,747,630 I617F possibly damaging Het
F12 T C 13: 55,418,137 N132D probably benign Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Frs3 T G 17: 47,703,636 I418S probably damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Il17rb A G 14: 30,008,772 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mtus2 C A 5: 148,295,506 H120Q probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nes C A 3: 87,973,122 probably benign Het
Nid2 T A 14: 19,763,711 Y195N probably damaging Het
Nlrp9c A T 7: 26,371,451 C790S probably damaging Het
Olfr1448 A T 19: 12,919,667 I214N probably benign Het
Phf24 T G 4: 42,937,879 Y85* probably null Het
Pycr1 T C 11: 120,642,246 S33G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sirt2 A G 7: 28,767,671 E19G probably damaging Het
Sort1 T C 3: 108,337,909 V359A possibly damaging Het
Tnni1 A G 1: 135,805,053 probably null Het
Ube2q1 T A 3: 89,781,076 M183K probably damaging Het
Vmn1r50 T A 6: 90,107,494 F74I probably damaging Het
Other mutations in Celf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Celf3 APN 3 94488228 missense possibly damaging 0.70
IGL02103:Celf3 APN 3 94486801 missense probably damaging 1.00
IGL03007:Celf3 APN 3 94487137 missense probably benign 0.00
R0180:Celf3 UTSW 3 94485340 missense probably damaging 1.00
R0670:Celf3 UTSW 3 94488230 small deletion probably benign
R1965:Celf3 UTSW 3 94485327 missense probably damaging 1.00
R2232:Celf3 UTSW 3 94480259 splice site probably null
R2566:Celf3 UTSW 3 94488230 small deletion probably benign
R3546:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3547:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R4015:Celf3 UTSW 3 94487198 missense probably benign 0.02
R4471:Celf3 UTSW 3 94488278 splice site probably null
R4698:Celf3 UTSW 3 94484867 critical splice donor site probably null
R4816:Celf3 UTSW 3 94479222 missense probably damaging 1.00
R4939:Celf3 UTSW 3 94488230 small deletion probably benign
R5851:Celf3 UTSW 3 94479126 missense probably damaging 1.00
R6277:Celf3 UTSW 3 94485365 missense probably damaging 1.00
R6400:Celf3 UTSW 3 94480286 missense probably damaging 1.00
R6986:Celf3 UTSW 3 94487717 missense possibly damaging 0.83
R7357:Celf3 UTSW 3 94480330 missense probably damaging 0.99
R7556:Celf3 UTSW 3 94480283 missense probably damaging 1.00
R8141:Celf3 UTSW 3 94488543 missense probably damaging 1.00
R8290:Celf3 UTSW 3 94479182 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGGATAAGAACGCCCATGTG -3'
(R):5'- GATGTGACGAACTCAGTCCTAAG -3'

Sequencing Primer
(F):5'- CGATGGCTCTTTCCCAGG -3'
(R):5'- TCCTAAGAGTTCAAACAAAAATGTCC -3'
Posted On2015-02-19