Incidental Mutation 'R3548:Clcc1'
ID268299
Institutional Source Beutler Lab
Gene Symbol Clcc1
Ensembl Gene ENSMUSG00000027884
Gene Namechloride channel CLIC-like 1
SynonymsMclc
MMRRC Submission 040667-MU
Accession Numbers

Ncbi RefSeq: NM_001177770.1, NM_145543.2, NM_001177771.1; MGI:2385186

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3548 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108653913-108678840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108668113 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 169 (C169S)
Ref Sequence ENSEMBL: ENSMUSP00000102224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029483] [ENSMUST00000106609] [ENSMUST00000106613] [ENSMUST00000124384]
Predicted Effect probably benign
Transcript: ENSMUST00000029483
AA Change: C164S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029483
Gene: ENSMUSG00000027884
AA Change: C164S

DomainStartEndE-ValueType
Pfam:MCLC 3 539 2e-266 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106609
AA Change: C164S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102220
Gene: ENSMUSG00000027884
AA Change: C164S

DomainStartEndE-ValueType
Pfam:MCLC 3 539 2e-266 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106613
AA Change: C169S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102224
Gene: ENSMUSG00000027884
AA Change: C169S

DomainStartEndE-ValueType
Pfam:MCLC 8 544 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124384
SMART Domains Protein: ENSMUSP00000118529
Gene: ENSMUSG00000027884

DomainStartEndE-ValueType
Pfam:MCLC 3 84 4.2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156811
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.8%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation show strain-dependent cerebellar granule cell death and peripheral motor axon degeneration. The peripheral neuropathy, neurogenic muscular atrophy and mild truncal ataxia observed on the C57BL/6J background is not found on the C3H/HeSnJ background. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted(1) Gene trapped(11)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
Amph C A 13: 19,102,959 H279Q probably damaging Het
Ankrd28 A G 14: 31,715,260 L646S probably benign Het
Arntl A T 7: 113,313,545 I610F probably damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Chrnb2 T A 3: 89,761,591 Y139F probably benign Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Cr2 A T 1: 195,155,888 C1089* probably null Het
Dnah10 A T 5: 124,747,630 I617F possibly damaging Het
F12 T C 13: 55,418,137 N132D probably benign Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Frs3 T G 17: 47,703,636 I418S probably damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Il17rb A G 14: 30,008,772 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mtus2 C A 5: 148,295,506 H120Q probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nes C A 3: 87,973,122 probably benign Het
Nid2 T A 14: 19,763,711 Y195N probably damaging Het
Nlrp9c A T 7: 26,371,451 C790S probably damaging Het
Olfr1448 A T 19: 12,919,667 I214N probably benign Het
Phf24 T G 4: 42,937,879 Y85* probably null Het
Pycr1 T C 11: 120,642,246 S33G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sirt2 A G 7: 28,767,671 E19G probably damaging Het
Sort1 T C 3: 108,337,909 V359A possibly damaging Het
Tnni1 A G 1: 135,805,053 probably null Het
Ube2q1 T A 3: 89,781,076 M183K probably damaging Het
Vmn1r50 T A 6: 90,107,494 F74I probably damaging Het
Other mutations in Clcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Clcc1 APN 3 108670903 missense probably benign 0.04
IGL01683:Clcc1 APN 3 108676796 missense probably benign 0.00
IGL02067:Clcc1 APN 3 108668721 missense probably damaging 0.99
IGL02341:Clcc1 APN 3 108673383 missense possibly damaging 0.60
B6584:Clcc1 UTSW 3 108672913 missense probably damaging 1.00
R0014:Clcc1 UTSW 3 108661396 nonsense probably null
R0733:Clcc1 UTSW 3 108674740 missense probably benign 0.00
R1151:Clcc1 UTSW 3 108668043 missense probably damaging 1.00
R1432:Clcc1 UTSW 3 108668102 missense probably benign 0.11
R3546:Clcc1 UTSW 3 108668113 missense probably benign 0.00
R3547:Clcc1 UTSW 3 108668113 missense probably benign 0.00
R3932:Clcc1 UTSW 3 108673366 missense probably damaging 1.00
R4210:Clcc1 UTSW 3 108663591 missense possibly damaging 0.90
R4211:Clcc1 UTSW 3 108663591 missense possibly damaging 0.90
R4756:Clcc1 UTSW 3 108672920 splice site probably null
R4856:Clcc1 UTSW 3 108676838 missense probably benign 0.02
R4886:Clcc1 UTSW 3 108676838 missense probably benign 0.02
R5858:Clcc1 UTSW 3 108661428 missense probably damaging 1.00
R6258:Clcc1 UTSW 3 108673308 missense possibly damaging 0.73
R6301:Clcc1 UTSW 3 108673366 missense probably damaging 1.00
R6414:Clcc1 UTSW 3 108676851 missense possibly damaging 0.90
R6944:Clcc1 UTSW 3 108670968 missense probably damaging 1.00
R6965:Clcc1 UTSW 3 108673309 missense probably damaging 0.99
R7331:Clcc1 UTSW 3 108668078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTAACTGACGTAGCCTG -3'
(R):5'- AGCAGTGAAACAGCCCTAAG -3'

Sequencing Primer
(F):5'- CTGACGTAGCCTGATGAGAAC -3'
(R):5'- CAGCTTCAGATGAAATGACCTG -3'
Posted On2015-02-19