Incidental Mutation 'R3548:Fhit'
ID268314
Institutional Source Beutler Lab
Gene Symbol Fhit
Ensembl Gene ENSMUSG00000060579
Gene Namefragile histidine triad gene
SynonymsFra14A2
MMRRC Submission 040667-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R3548 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location9550092-11162035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9870095 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 125 (T125A)
Ref Sequence ENSEMBL: ENSMUSP00000124017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160340] [ENSMUST00000160956] [ENSMUST00000161302] [ENSMUST00000161895] [ENSMUST00000162278] [ENSMUST00000162817] [ENSMUST00000179394]
Predicted Effect probably benign
Transcript: ENSMUST00000160340
AA Change: T125A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124017
Gene: ENSMUSG00000060579
AA Change: T125A

DomainStartEndE-ValueType
Pfam:DcpS_C 60 170 2e-9 PFAM
Pfam:HIT 72 168 6.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160956
SMART Domains Protein: ENSMUSP00000123820
Gene: ENSMUSG00000060579

DomainStartEndE-ValueType
Pfam:HIT 9 57 6.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161179
Predicted Effect probably benign
Transcript: ENSMUST00000161302
AA Change: T62A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123874
Gene: ENSMUSG00000060579
AA Change: T62A

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161895
AA Change: T62A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124957
Gene: ENSMUSG00000060579
AA Change: T62A

DomainStartEndE-ValueType
Pfam:DcpS_C 6 110 4.3e-10 PFAM
Pfam:HIT 9 105 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162278
AA Change: T62A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124073
Gene: ENSMUSG00000060579
AA Change: T62A

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162817
AA Change: T62A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124500
Gene: ENSMUSG00000060579
AA Change: T62A

DomainStartEndE-ValueType
Pfam:DcpS_C 5 100 2.3e-7 PFAM
Pfam:HIT 9 100 1.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179394
AA Change: T62A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136011
Gene: ENSMUSG00000060579
AA Change: T62A

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Meta Mutation Damage Score 0.0750 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: This gene encodes a member of the HIT family of proteins that are characterized by the presence of a histidine triad sequence. The encoded protein is a diadenosine triphosphate hydrolase enzyme that cleaves the P(1)-P(3)-bis(5'-adenosyl) triphosphate (Ap3A) to yield AMP and ADP. This locus is very fragile and has been found to be altered in different types of cancers. Mice lacking the encoded protein display increased susceptibility to spontaneous and induced tumors. Ectopic expression of the encoded protein in such knockout mice inhibits tumor development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Both homozygotes and heterozygotes for a targeted null mutation exhibit a similarly increased incidence of both spontaneous and nitrosomethylbenzalamine-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
Amph C A 13: 19,102,959 H279Q probably damaging Het
Ankrd28 A G 14: 31,715,260 L646S probably benign Het
Arntl A T 7: 113,313,545 I610F probably damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Chrnb2 T A 3: 89,761,591 Y139F probably benign Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Cr2 A T 1: 195,155,888 C1089* probably null Het
Dnah10 A T 5: 124,747,630 I617F possibly damaging Het
F12 T C 13: 55,418,137 N132D probably benign Het
Frs3 T G 17: 47,703,636 I418S probably damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Il17rb A G 14: 30,008,772 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mtus2 C A 5: 148,295,506 H120Q probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nes C A 3: 87,973,122 probably benign Het
Nid2 T A 14: 19,763,711 Y195N probably damaging Het
Nlrp9c A T 7: 26,371,451 C790S probably damaging Het
Olfr1448 A T 19: 12,919,667 I214N probably benign Het
Phf24 T G 4: 42,937,879 Y85* probably null Het
Pycr1 T C 11: 120,642,246 S33G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sirt2 A G 7: 28,767,671 E19G probably damaging Het
Sort1 T C 3: 108,337,909 V359A possibly damaging Het
Tnni1 A G 1: 135,805,053 probably null Het
Ube2q1 T A 3: 89,781,076 M183K probably damaging Het
Vmn1r50 T A 6: 90,107,494 F74I probably damaging Het
Other mutations in Fhit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Fhit APN 14 9573483 missense probably benign 0.19
IGL01412:Fhit APN 14 9870065 missense probably damaging 1.00
IGL02831:Fhit APN 14 9870080 missense probably benign 0.00
IGL03025:Fhit APN 14 10421534 missense probably damaging 1.00
overtax UTSW 14 10421534 missense probably damaging 1.00
R0464:Fhit UTSW 14 10991567 start gained probably benign
R0544:Fhit UTSW 14 9870172 missense probably damaging 1.00
R3545:Fhit UTSW 14 9870095 missense probably benign 0.03
R3547:Fhit UTSW 14 9870095 missense probably benign 0.03
R4033:Fhit UTSW 14 10751671 intron probably benign
R4685:Fhit UTSW 14 9870091 missense probably damaging 1.00
R4968:Fhit UTSW 14 10421522 missense probably damaging 1.00
R5624:Fhit UTSW 14 10421534 missense probably damaging 1.00
R6011:Fhit UTSW 14 9870068 missense probably benign 0.16
R6061:Fhit UTSW 14 9573435 missense probably benign 0.00
R6208:Fhit UTSW 14 9573435 missense probably benign 0.00
R6846:Fhit UTSW 14 9763762 missense possibly damaging 0.73
R7288:Fhit UTSW 14 9763784 missense probably damaging 1.00
R7625:Fhit UTSW 14 9870177 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGCTGTTATATAAATGCAGACCAC -3'
(R):5'- TAGTCTGCAAGATTCCAGGCC -3'

Sequencing Primer
(F):5'- TGCAGACCACAAAAACCATTTCTCTG -3'
(R):5'- CCCAAGTCAATGGAACTCGGG -3'
Posted On2015-02-19