Incidental Mutation 'R3551:Sema4c'
ID 268319
Institutional Source Beutler Lab
Gene Symbol Sema4c
Ensembl Gene ENSMUSG00000026121
Gene Name sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
Synonyms M-Sema F, Semacl1, Semaf, Semai, Semacl1
MMRRC Submission 040668-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3551 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 36587720-36597430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 36592804 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 138 (T138S)
Ref Sequence ENSEMBL: ENSMUSP00000141527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114991] [ENSMUST00000191642] [ENSMUST00000191677] [ENSMUST00000193382] [ENSMUST00000195620] [ENSMUST00000195339]
AlphaFold Q64151
Predicted Effect probably benign
Transcript: ENSMUST00000114990
AA Change: T138S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000110641
Gene: ENSMUSG00000026121
AA Change: T138S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114991
AA Change: T138S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000110643
Gene: ENSMUSG00000026121
AA Change: T138S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149224
Predicted Effect probably benign
Transcript: ENSMUST00000191642
AA Change: T138S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142284
Gene: ENSMUSG00000026121
AA Change: T138S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191677
AA Change: T138S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000141263
Gene: ENSMUSG00000026121
AA Change: T138S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191785
Predicted Effect probably benign
Transcript: ENSMUST00000193382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195160
Predicted Effect probably benign
Transcript: ENSMUST00000195620
AA Change: T138S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000141527
Gene: ENSMUSG00000026121
AA Change: T138S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195339
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,152,450 (GRCm39) Y866N probably damaging Het
Adam24 G C 8: 41,132,632 (GRCm39) W33C probably benign Het
Adgrl2 A T 3: 148,564,599 (GRCm39) V327E probably damaging Het
Aqp7 T A 4: 41,045,329 (GRCm39) N17I probably benign Het
Bicra T A 7: 15,713,658 (GRCm39) Q848L probably benign Het
C4b T C 17: 34,960,846 (GRCm39) E240G possibly damaging Het
Ccni T C 5: 93,335,620 (GRCm39) S173G probably benign Het
Clca3a2 T A 3: 144,508,842 (GRCm39) N50I probably damaging Het
Dcaf7 A G 11: 105,945,622 (GRCm39) T324A probably benign Het
Dnah12 G A 14: 26,492,929 (GRCm39) R1230H probably benign Het
Dsg4 G A 18: 20,584,813 (GRCm39) V176M probably damaging Het
Ect2l A G 10: 18,039,141 (GRCm39) I339T probably damaging Het
Edc4 A T 8: 106,612,126 (GRCm39) I138F probably damaging Het
Ercc6l2 T A 13: 63,992,409 (GRCm39) V401E probably damaging Het
Gm3269 T A 14: 16,033,003 (GRCm39) V260D possibly damaging Het
Gm4076 C T 13: 85,275,269 (GRCm39) noncoding transcript Het
Gm4922 A T 10: 18,660,244 (GRCm39) N159K probably benign Het
Gm5134 G T 10: 75,836,281 (GRCm39) A421S probably benign Het
Hrc G C 7: 44,985,757 (GRCm39) E303Q possibly damaging Het
Ipo4 A G 14: 55,870,560 (GRCm39) V288A probably benign Het
Kng2 A G 16: 22,830,745 (GRCm39) probably null Het
Lrfn1 T C 7: 28,159,479 (GRCm39) L466P possibly damaging Het
Magi1 T A 6: 93,676,610 (GRCm39) K916N probably damaging Het
Mms19 T C 19: 41,938,237 (GRCm39) T720A probably benign Het
Muc5b A G 7: 141,415,072 (GRCm39) T2673A possibly damaging Het
Myo15a C T 11: 60,400,489 (GRCm39) A1767V possibly damaging Het
Npas2 A T 1: 39,326,643 (GRCm39) M43L probably benign Het
Nup43 A G 10: 7,550,778 (GRCm39) D216G possibly damaging Het
Or1e19 T C 11: 73,316,678 (GRCm39) I44V probably benign Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pcdhga6 G T 18: 37,841,270 (GRCm39) R330L probably benign Het
Pear1 A G 3: 87,665,439 (GRCm39) F145L probably benign Het
Pgap1 A G 1: 54,569,302 (GRCm39) S355P possibly damaging Het
Prr14l A T 5: 32,985,963 (GRCm39) probably null Het
Ptpn12 T C 5: 21,194,047 (GRCm39) K742E possibly damaging Het
Ryr1 T A 7: 28,756,422 (GRCm39) Q3464L probably damaging Het
Slc4a2 C T 5: 24,635,099 (GRCm39) T168M probably benign Het
Slco1a7 T C 6: 141,654,322 (GRCm39) K647E probably benign Het
Spice1 G T 16: 44,178,232 (GRCm39) S85I probably damaging Het
Thrb T A 14: 17,963,214 (GRCm38) I59N probably damaging Het
Trav7-1 A G 14: 52,892,756 (GRCm39) D103G probably damaging Het
Ubap2l G T 3: 89,922,758 (GRCm39) T766N unknown Het
Zfp692 C T 11: 58,200,254 (GRCm39) T170I possibly damaging Het
Zfp704 A G 3: 9,539,585 (GRCm39) V255A probably damaging Het
Zfp759 T C 13: 67,287,031 (GRCm39) V194A probably benign Het
Other mutations in Sema4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Sema4c APN 1 36,593,001 (GRCm39) critical splice donor site probably benign 0.00
IGL01824:Sema4c APN 1 36,592,110 (GRCm39) missense possibly damaging 0.76
IGL02236:Sema4c APN 1 36,592,166 (GRCm39) missense probably damaging 1.00
IGL02262:Sema4c APN 1 36,589,422 (GRCm39) missense probably damaging 1.00
IGL02282:Sema4c APN 1 36,589,284 (GRCm39) splice site probably null
IGL02476:Sema4c APN 1 36,595,031 (GRCm39) missense probably damaging 0.98
IGL02900:Sema4c APN 1 36,589,826 (GRCm39) nonsense probably null
swirl UTSW 1 36,589,392 (GRCm39) missense probably damaging 1.00
IGL02837:Sema4c UTSW 1 36,591,965 (GRCm39) missense probably damaging 1.00
R0427:Sema4c UTSW 1 36,592,892 (GRCm39) nonsense probably null
R0497:Sema4c UTSW 1 36,588,689 (GRCm39) missense probably benign 0.04
R1066:Sema4c UTSW 1 36,589,281 (GRCm39) missense possibly damaging 0.95
R1099:Sema4c UTSW 1 36,591,191 (GRCm39) missense probably damaging 1.00
R1146:Sema4c UTSW 1 36,589,646 (GRCm39) missense probably benign 0.04
R1146:Sema4c UTSW 1 36,589,646 (GRCm39) missense probably benign 0.04
R1639:Sema4c UTSW 1 36,592,615 (GRCm39) missense probably benign 0.00
R1644:Sema4c UTSW 1 36,589,885 (GRCm39) missense probably damaging 1.00
R3176:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3177:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3276:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3277:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R4452:Sema4c UTSW 1 36,592,837 (GRCm39) missense probably benign 0.31
R4883:Sema4c UTSW 1 36,591,097 (GRCm39) missense probably damaging 0.98
R4895:Sema4c UTSW 1 36,592,651 (GRCm39) splice site probably null
R4913:Sema4c UTSW 1 36,589,266 (GRCm39) missense probably benign 0.11
R4944:Sema4c UTSW 1 36,589,392 (GRCm39) missense probably damaging 1.00
R5062:Sema4c UTSW 1 36,592,059 (GRCm39) critical splice donor site probably null
R5077:Sema4c UTSW 1 36,590,812 (GRCm39) missense probably benign 0.20
R5109:Sema4c UTSW 1 36,591,381 (GRCm39) frame shift probably null
R5208:Sema4c UTSW 1 36,589,407 (GRCm39) missense probably damaging 1.00
R5551:Sema4c UTSW 1 36,591,398 (GRCm39) missense probably damaging 1.00
R5912:Sema4c UTSW 1 36,593,469 (GRCm39) missense possibly damaging 0.83
R6578:Sema4c UTSW 1 36,589,834 (GRCm39) missense probably benign 0.02
R7111:Sema4c UTSW 1 36,592,160 (GRCm39) missense possibly damaging 0.48
R7141:Sema4c UTSW 1 36,592,101 (GRCm39) missense probably damaging 0.99
R7252:Sema4c UTSW 1 36,589,096 (GRCm39) missense probably damaging 1.00
R7495:Sema4c UTSW 1 36,589,774 (GRCm39) missense probably benign 0.00
R7891:Sema4c UTSW 1 36,588,995 (GRCm39) missense probably damaging 0.98
R7895:Sema4c UTSW 1 36,592,199 (GRCm39) missense probably damaging 1.00
R8264:Sema4c UTSW 1 36,591,966 (GRCm39) missense probably damaging 1.00
R8478:Sema4c UTSW 1 36,590,871 (GRCm39) missense probably benign 0.04
R8680:Sema4c UTSW 1 36,589,867 (GRCm39) missense probably benign 0.00
R8733:Sema4c UTSW 1 36,591,954 (GRCm39) missense probably damaging 1.00
R9017:Sema4c UTSW 1 36,592,079 (GRCm39) missense probably damaging 1.00
R9344:Sema4c UTSW 1 36,592,395 (GRCm39) missense probably damaging 1.00
R9488:Sema4c UTSW 1 36,591,067 (GRCm39) missense probably benign
X0019:Sema4c UTSW 1 36,592,077 (GRCm39) missense probably damaging 1.00
X0028:Sema4c UTSW 1 36,589,047 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AACGTGAGCATGTTCTAGGG -3'
(R):5'- TCAGATCTCTTGGGAGGCTC -3'

Sequencing Primer
(F):5'- CATGTTCTAGGGGCAGGAAGACATC -3'
(R):5'- TTAGAGAGCTTCCCCTGCCAG -3'
Posted On 2015-02-19