Incidental Mutation 'R3551:Pgap1'
ID268321
Institutional Source Beutler Lab
Gene Symbol Pgap1
Ensembl Gene ENSMUSG00000073678
Gene Namepost-GPI attachment to proteins 1
SynonymsPGAP1, D230012E17Rik, oto, 5033403E17Rik, 9030223K07Rik
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location54472994-54557684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54530143 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 355 (S355P)
Ref Sequence ENSEMBL: ENSMUSP00000095346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097739]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097739
AA Change: S355P

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095346
Gene: ENSMUSG00000073678
AA Change: S355P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:PGAP1 82 302 7.2e-83 PFAM
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
transmembrane domain 819 838 N/A INTRINSIC
low complexity region 854 866 N/A INTRINSIC
low complexity region 871 884 N/A INTRINSIC
transmembrane domain 902 921 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187949
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions early in the glycosylphosphatidylinositol (GPI) biosynthetic pathway, catalyzing the inositol deacylation of GPI. The encoded protein is required for the production of GPI that can attach to proteins, and this may be an important factor in the transport of GPI-anchored proteins from the endoplasmic reticulum to the Golgi. Defects in this gene are a cause of mental retardation, autosomal recessive 42. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mutations in this gene result in a variety of forebrain, eye, jaw, craniofacial, ear, and vertebra defects that are background sensitive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Pgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Pgap1 APN 1 54492021 splice site probably benign
IGL01111:Pgap1 APN 1 54530943 missense probably benign 0.17
IGL01406:Pgap1 APN 1 54533414 splice site probably null
IGL01592:Pgap1 APN 1 54521311 missense probably damaging 1.00
IGL02005:Pgap1 APN 1 54551055 missense probably damaging 0.99
IGL02026:Pgap1 APN 1 54494819 missense probably benign 0.05
IGL02086:Pgap1 APN 1 54547988 missense probably damaging 1.00
IGL02354:Pgap1 APN 1 54512816 missense probably benign 0.02
IGL02361:Pgap1 APN 1 54512816 missense probably benign 0.02
IGL02995:Pgap1 APN 1 54493350 missense probably benign 0.19
IGL03012:Pgap1 APN 1 54533413 splice site probably benign
R0044:Pgap1 UTSW 1 54493368 missense probably damaging 1.00
R0109:Pgap1 UTSW 1 54494825 missense probably damaging 1.00
R0109:Pgap1 UTSW 1 54494825 missense probably damaging 1.00
R0241:Pgap1 UTSW 1 54535951 splice site probably null
R0241:Pgap1 UTSW 1 54535951 splice site probably null
R0352:Pgap1 UTSW 1 54486458 splice site probably benign
R1297:Pgap1 UTSW 1 54528523 missense possibly damaging 0.94
R1429:Pgap1 UTSW 1 54494861 missense probably benign 0.01
R1465:Pgap1 UTSW 1 54528555 missense probably benign 0.11
R1465:Pgap1 UTSW 1 54528555 missense probably benign 0.11
R1542:Pgap1 UTSW 1 54492090 missense probably benign 0.16
R1816:Pgap1 UTSW 1 54492057 missense probably damaging 0.99
R1817:Pgap1 UTSW 1 54535969 missense probably benign 0.15
R1905:Pgap1 UTSW 1 54511961 missense probably benign 0.26
R2006:Pgap1 UTSW 1 54551061 missense possibly damaging 0.76
R3833:Pgap1 UTSW 1 54557465 missense probably damaging 0.99
R3901:Pgap1 UTSW 1 54493348 missense probably benign
R4487:Pgap1 UTSW 1 54528592 missense probably benign 0.26
R4874:Pgap1 UTSW 1 54530137 missense probably damaging 0.96
R5184:Pgap1 UTSW 1 54481856 missense probably damaging 1.00
R6181:Pgap1 UTSW 1 54512777 missense probably benign 0.05
R6212:Pgap1 UTSW 1 54514893 missense probably damaging 0.99
R6269:Pgap1 UTSW 1 54548008 nonsense probably null
R6525:Pgap1 UTSW 1 54481889 missense probably benign 0.00
R6944:Pgap1 UTSW 1 54530161 missense probably damaging 1.00
R7214:Pgap1 UTSW 1 54543061 missense possibly damaging 0.47
R7256:Pgap1 UTSW 1 54493207 critical splice donor site probably null
R7290:Pgap1 UTSW 1 54548066 missense possibly damaging 0.45
R7356:Pgap1 UTSW 1 54530134 missense probably benign 0.10
R7525:Pgap1 UTSW 1 54530922 missense probably benign 0.26
R7602:Pgap1 UTSW 1 54543186 missense probably damaging 1.00
R7897:Pgap1 UTSW 1 54551008 missense probably damaging 1.00
R8278:Pgap1 UTSW 1 54490271 missense probably benign
X0025:Pgap1 UTSW 1 54481870 missense probably benign 0.26
X0060:Pgap1 UTSW 1 54536034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAAGAAGAGGTTCCAGGCG -3'
(R):5'- ATCTCTTAAAGCAGCCCGTG -3'

Sequencing Primer
(F):5'- GTAGACTCCATCAGGCATTTAGATCC -3'
(R):5'- CTCTTAAAGCAGCCCGTGTGTAAG -3'
Posted On2015-02-19